Description :
From Genome Similarity Track
Location :
Scaffold_48:62533- 70222
Transcript NameFunction/comments
Physo_136738hypothetical protein
Physo_136739predicted protein

Sequence
7689 bases(100 bases per row)
GTCTTCCCCTCCCGCGTCGTTGATACAGATTGAGAGCGCTTGAACACGCGGGTACACCGTAGTCGTGGATCCGTCGGCGGTATACTCCTGCAGTCCTGCT
GACCCTAAAATGCACGACTCGGTGTTGCAGAAGTAGTCGTAGATAGGCGTTGTCACTGGAGGAATTGTCCTCCTGATACCCGATCATTTGCGTCGGGATC
TCGATCGCGAAGGCGTCAAACGCCACGGTCTCAGCCAAATCAACGTGGGAAAACTCCATCGTGGCCAGCTCGTCCGTCGTACTCGCGTTCTCGGCCTTCT
CAAAGTACTCGACAATCACCCCGTGGAGGTTACGGAGGAAATCGGGCGAGGAGGCCGTCAGATTCAGATAGTCCGCCATGACCAGGGGAATCGACTGGTT
CCTATTGACGTAACCTGGAGCGTAAATGCTCCACGCCTCGTCCGTTGAGCTCCACCACCCGAGGAAGCTGTTGCTCACTATCAGCGCGTACGTCGCGAGG
TTGGTCGCGATCGACTGGTTCATCAGGAGTTCGTAGTCTGCTGGAAGATCGCTAGTCGCAGCGTTCATGGGCATAGCCACGGAAGCTGTTGGGGTTAAAG
CTTGCGATAGCGCGAGCTGCTGCCACGATCGAGACGGGAAGCCGTAGCTCGCAGCGATGTTCTTGAACGGGGACACGAAGGCGTCCGTGTGGTTGCACCA
CGTCGGGACGTTCTCGGTCGGTACGAATAGCTTGCGCATGATGGTGTTGAGGACGCTGTTGCCGGCTGTGTCTTCACGGAAGCTGTGACTCCACGTGGTG
GTCACGAATCCGTCGGCACTCAGTTGTTGAGCGGTGTCGTCACTAGAGCTCTGCTCTGCGAGGTCAGCGGCGAGAATCCGTGGGTGGATGTCCCCCGAGA
TCACTTGGACGTTGAGGGAGCTAAGACCAGTGTTCATGAGGTACCCCACAGCAGCCACGGCAGCCATGGCAAGGTACGCGCGTCGCTCCCCGAGTTGACT
GAACTTGGTCGCGAGGCACAGGAAGGCGACGGAGATGACCATACTCAGCACCACGTCGACTGGCTTCATGAGCAGAGCGGTATTGGCTCCGGAGATGGAG
TTGTACCGGTCCAGCATCTTCTTCTGCTCGGCTGCGTCCATGTCGGTGGACTCGAAGGTTCGAACGCGCACTCCGTCGCTGGCGAACGGCAGCATGACAC
CGACGAGAATGCCGCCCACGATGAGAGATCCGAAGAGCACGCGGAAGCGGTAGACGTCCACGAACAGCGAGTAGTTGGGTGAACCTTCGACATCGTTGAA
AGGGGCGTATGCCGGTGTCGCGGGAGTTTGTACCCCCGCCTCCGACTCCTTCGTGTTCTCCGGCATCGATGCGCGCGCGACTTGGTGGAATGAACAATGA
CTAGGGGGGAACGTGCTGCCATGCCATGACCACGTGAAGGAGACATGCTGAACGTACCTATCTGATCAGTTCTGTATCCTCCTATGGGTAAAGTTGGACA
ACGGGTAGACGTTTAGTCCGTTAGTTCGTGAAGGATATCAGAGAGATGATCGATGAAGCCGAACAGCGCGTGGTACTTCGCGTTCTACTCGTTCGACAAA
TGGGTTCAAGCCATTGCAGCAAACTCTACTTCGTGACTGAGAAACATAGGCAAGTTTTGACAGCAATGCAAAAACACCTACTGCATGCATATGCAGTGAG
TGAGGAAAGGGCTTTCGTATTTGATCTCAATATGGCCATCAAAGCGAATGACGGAGATACAGTACATCGTATCGAATGCGATGACTCAGACGTTACACTT
GTTAGTTTGAAGCCATCGACCGTTGATTCGAGCTTCGACTAGCGGGATGCTTTCTGGTGCCTGGTTTAGAGGCTGTGCTCAACATATCAACAGCAAGCAC
TGTATCCAACTCCTTGCCAATAAGGTCAACCCCTTACGAATAGCTAACTACTGAGTTTGGTCTTCCTTATAAAACAACATCATACTTCCAACATGCAGCG
AGTCGAACAAAGCTCCTGAGCTTCCCCCGTGCCGGAATCTCGTAGCTTCAAGCGCAGTAAAAAGGGGGAAAAACTTCTTTAGATTTCCCAGTGCGCTAGG
TATTCGAGATAGCGGCAATAATACTACACAGTCTGCAATGCGCTCACAACGCTTGCAGGCGGAATCGATGCTTGCTTGCTCGAACATAACGAGAATATTG
GGGCTCGCTCTCGGCAAGAATCTGACGATAAATAAAATCCAAGCCGTCGTGGCATACATTAGCGATGCAGTCTGAAGGCTTCGGCAAGTAGTGAATCATG
TATTGGAGTAACTTGTTCTACCGCCTAATAGCTGGTAATCTTTCCGACACACTGCGTCACCTCGATATCAAATGTTGCTTTGCACGTCGTCCGGTTCTTG
CTTCGGTAGAGCTGCAACGCAAACCCGTCGTAAATGTCGCTCGAGACGATGAACAGAAGGCTATGCGAATAAGATGAAAATTCTTTCCCTTATGTAGCTT
GAATAGACTTGATTTTTTCCTGAATTGGACCCCATTTTCAGCACATCCAACGGCCTGTCCATCGAGATATGCCAAACAAAACTTCTTGGTAGTGAGGTCT
TGCAGAACGACTTCTCTCCCTCGCCACGACTGCAGATTCTGCTCTGAAGTCATCAACCACGAGCGGATTTCATCGACTGAGCTCGCATTATACCGAGTGA
TGACAATCGCCTCCACTGCCAAAGACGAATACCCCACGTAGGGGAGGCTGGGCAGTGCCACATCGCGATACAAACTGAATATGAGGTGCTTCATCGTGTC
ACTAAACGCACACCGCCTGAAGAGTAGAATATATCCTCTTTGAACTCGGCAACCGTCTCCGGAATTTCATCCTCCACACGTTTTACCAGTAGCTCGAGTA
ATTCCGACCGTGAAAACAGGAACCTCGGCTTACCGCAAAGAGCTTAAATCGCTGAATCCATTCGCCTTCATCCTCCACGTGAATATTACTGGCGAATTCT
TCGCACTCAGCTTTAGTCCATGGATTCAGATACACCGTAAAGCACGAATCCTTCCTAAAGTGGTTGAAGTTTTCACGGCGAGGGCTGGCGAGGAGATACA
CATGGCGAAAATGGCCATAGATAAACGCGGTGTTGTGGTCATTTTCATCAAAGAAGCCCTCGTAGGTTTTCCCAGGATGAGGCGCAAGCGATGCTTCGTA
GTCTCCTGCCCCGGTCCAAGTGAAGTAGTAAATCTTGGAATCAACTGCAGGATGATAGGCGACGTCCCTCCTTCCGTCATGAACTTGAGGAACAAGAACA
CTCCAAACACCGACCTCCCAATCCCAGGACTGCCGATAACTAGGACTCTGCGCGCACACTCCAGTTTCTCCGTGATCATCGCATAGACGTCCAAATACTC
TTGACGAACGTATAAACCGTTGGGCAAAGTCGTCCAAGAAGTTTTCTGGAAGTCCCGATACTAAACTTTCTACAGCCAGCTTGGATTCACTTAGATGGTG
AGCAAGTTGGGCGATTGCGAGCGTGTCAAACCCGGAGATGACTTCTTCGACCTCGCGTTTCCTTTTAGCTGCTGACCATTTCGGAACAACCACCAGCACG
TGAACTTGATCGTCATCCGGTTGAAAATTGTCTCCAAAGTAATTAAGGTTCTTGAAACGAAGCGCGGGGTTCAGCCACTTAAAGCCTTGATGGCGCTCAT
GTTCATCGAGATCCAGCGAGAGTGTTGTGTCTAGCGTCACAGCCATCGCATCAGTCGCACTCAACCACTTGCCGTCAGTCTTCTTGGCCAGGAAGAGCTG
CAGGTTGGGGGCGTCGACATCCTTCAACGTATTCGGGTTTTCCTGCTCGATAGGTTCCTTCAACTCGCCCACCTTCGCGCCATCGTCGACTTCCACGTCG
AACGTGCTGCCCACACCAACAATCGCGCAAGTGAGTAATATCTTCCACATCGTTCCTCAAGGCCGCAGATTCTCAAATGAGAATGAGATTTCTGTGACGT
AGAGTGTACTAACCACCGAAAACCTCCTGCTGAAGCCCCTTGACCCGCAAGGCAAAGTCATTCGAACCGCTTGTGAGCGAGAGCAGTGCCAGTTCATCCT
CCAGCGCCTTCACTCGAGCATTGGCTTCATCCAGTTGTGCCTGCTTCTCTTGAGTCTGCTGCTCGGCACGACGCAGCAGCGCGTTCTGGTTGTTCCGGGT
TCTGGTTTAGGCTTTTACGTAAGTAGTTGCCGGTAGTCTTACAGGGCTTTTGCTTATCTCCTGACACGGTTCTTCAAGATGCAGGTTTTACTCCAGCTCG
CAAAACTTCAGTTTGCATGCTTTTGTTAATTGCCAACAACTGTGCCGACAAACTTACTTATTGAGCCTATTAACCTGTGCAAACCGCGTACTCGGTATCA
ACCTCAACATCCAGCTTCATGACTTTGAAATGTGAACGCATTGCCTTGTAGTCGATGAATCCTCCGCTAGGTTCCATCCTCTTCCTCAAAATTTCTTCGG
CGGCTTTGTCAACATGTTCCTCACTGCCTTTAAGCACCGACTTGAGAGCTGTTTTGTTGGCTGAATTCATTGGGACGATAGGTGTACATGCTGGATGATA
CGCCAATGTTCCATGGAACCGCTCCGTCTCGTCTCGGGTCAAGAGGAAGCAATCACTCGGCACAACATAGTCCTGAAGATTTGACGGGGCAACGCAATTC
ATGACCCCTCCCACCAAACGCGTGCCTTTCTCGAGAAATGCAGGGCGGGATTTCCTCAGCTTGCGAAGATACTCCCTTGCTGATTTTGGCTGAAATTTAC
CGAAATGCCGTTTTCTTTGGTCCACAAAGACAATCAAATTCTCAGAAAGAGCATCCTTCAGAGCAAAGAAAATATCGACGCCAGCTCCACCAACCCCATT
CACAATGATGTTGCCACTTGACGTCCAGTCGGCTTTTTCCGCTAGATGGTCTTTTCGTGAAACGACTTTGGGAGTTGAAGAACCATATTTTTCCGCACAC
TCAAACACTCTTGACGGAGCAAGTTTCACGGAAATGCGACGCGTGTCATCGCTCATCAGCGCCCCCGGCAGAAGCTCTCCCAGCGTCACAGTCGAGCGCC
CAAGGCCGAATCGTTGATCCCGGCCAAGGGGCGAGTGAAGGCGCCGCCTGTGGTGAGTGTGGAGATGTTGGAGCCAGACTATTCAGGAGTCGCACTGAGT
TTTGATGGCGCAGCTAAGACGTCCACGAAACGAGGAAGTTGCGGGTGTATACTGTGGCAGCTTCCCGAATGGACTGTCATCGAGGCTCGCGGCTACATCC
TGGATGGAGTGACAGTCAACGACGCGGAGTACTATGGACTACTGAAAGGCATGACCATGGCGCTCCAGCGGGGCATCGCGGACCTCGTGGTCGTAGGTGA
CTCAAGGATCGTCATTCAGCAAGTACAAGGACTCATCAACTGCAAACAGCCTAACCTGCAGCGGAGGCTCGCCGAATGCCATGTGCTCAAGGAGAAATTC
AGGACAGTCCGACTCGTACACGTCAAGCGTGAATATAACCAGGCCGCGGACTACTTGAACTCTAAGACACTGGCCCTGGGCGAAGATTGCGCGATTCAGG
ATGACGAGGAGCGACAGCACATGGAAGTGGTGTCCAAGATCCGAGAGCAATTGATGAAGACGATTATTGCTGGCCCAGATGAACAACCCGCAGATTCAGA
AAGTCCTTCTGGCTCCACTCCCGGAATATCCGCTGAAGTGAAGCCGGGCCCCGGCCCGGAATCTGCCCCGCTCACGGAGGCAGCCCGGGTAATGGCGGTG
CTGACAAGGACTCAGGCAGGACACACGCAGGATGAACGCCCACCCATGGGGCCCTTGGAATACCAGGGATTCGAGAAGGGAGATGCCGTATGGCTCCACA
TCCCGAAGGTCCAGCCTGGATTGAGCCGAAAACTAGCCCACCTGTGGCATGGCCCGTTCCGCATTGATGAGATTCGGGATGATTTTCGGGTGCGCCTCAA
GATCGAGGACACCGGCTACCGGGTTAACCCATGGGTCCACGTGAGTCGTCTCAAACCGAGGGCGGTCTTCCCGAAACGGCCCACGATTGAGCTGGACCTC
GATGATGAGGATGATTTCAACGCCGCGCTACTGCCCGAGGACAGTTGGGAACCCGATCATGCCAATGATGAGTACGAGGTCGAGAAGATTCTGGATTTGA
GATGGATCAAGAGGACGCGGATATCCAAGCGCACTCGAGAATACCTGATCAAGTGGAAGGGGTATGCAGACCCCGAATGGATCCCGCTGTCCCAACTCAG
CTGTGGGGCGCTACTGTACGAGTTCAACCAAGGGGCGAAGGCTAGGGCACGTTTCCAGGCTATGCAGGCTGGAGACGATCACCCCAGGCAATAGCCGTCC
TGAATGGAGGAAGCTCAACCGACCGTACCCGCAAGTTGTGAGACGACTGAACATGTTTTGATTACGAATGGAAATTTGGAGAGTATCGAGTGGAGACGAC
GCACTTTCAGGGTGCGGACGCTATGATGAACCTAAATGTGACGGTGAATGCGACGAAAGATGGGTCGTTGACATGATGAGAACAAGGTATAAGTCGTGAG
GGGAGACAACCGGGATGTCCATACCGTAACCCTTCTGGATCGCATCACCGTACATGAGAATCGTCTCTTCATCAGGAAGCATAATGAGTCCTTCCGGATG
CTGAGCCTGACTCCGGCACAGTACATGAAATCCATCCCGAGCAACACGTCCACGTCTTCTCCAATGTTCGTGACCCACAAATCCACAACGTACACGATTC
GAGGTCCCAGAGTATGGTGGTGGTGGATCAGTATAAAGCAGTCGAATCGGGGTTCTTAGAATCGGCTATTGTCAACTTCAACACATTCATCTCTCAGTTG
GCCTATCAACTGGTATTCAACGACTTTGTGATGCACCGCTCGACGAGGGTCACTATTGCTGCTGATTTCCGTGACGACGTAGCGCCCCCAACTCACACAC
TCTATGCATTTAGTACGCTTCCCCGGTACAAGCGTCTTAGCGGGACAATCTTGCGTGCGCAGCGCAAATGCAGTATTTGCGGGCGGAAGGCCTCATATTA
CTGCTCCGGGTGCTCTGATCCACTGGAAAACAATTTCTTTGAGGTTTGCGGCCTGAAGACAGGTCGGGACTGCCACTCACTCCATTTAAACACTACATTG
GTCTAACTAGTAACCTCTAAACGCTCTTTCTAATACATTTACTCATGCATTCAACTAATCAGCTTGAGCCCACCCGTGGGATATTTGCCGATCTCACGCG
TGGGCTTTTAAGCTGGATAGTAAAGGATAACGATTATCATAAGATTTTTCGACACAAATAGGGGGTTTCAAAGTAGCGATTTTTTGGACAGATCTTTTGC
AAAGGATGGGTCTGATCTTTTGACGGATATTTATCACGAGGGTACCACAACGAAGGGTGAATTTATCACGAGGGACCATAATCGATATGATTGACCAAAA
ACATTAGGTGCTTCACGCGCTTAGCGTTAGTCTGGCCATACTAACTATAGTCATAGACTCAACAACTAAAACCACAGTGCTACTAGTACTTCACAACACC
ATCATGAGTGCCCCCCAAGGAAGAGGATCCGCGCACGGCACCAGTGATATTGGACGTAGCACCAAACGTTTACGGAAAACCACCAAATA