Description :
From Genome Similarity Track
Location :
Scaffold_26:6253- 14963
Transcript NameFunction/comments
Phyag_g717hypothetical protein PHYSODRAFT_508417
Phyag_g718hypothetical protein PHYSODRAFT_504907
Phyag_g7192OG-Fe(II) oxygenase superfamily protein
Phyag_g720hypothetical protein PHYSODRAFT_346765
Phyag_g721hypothetical protein
Phyag_g722hypothetical protein PHYSODRAFT_286359

Sequence
8710 bases(100 bases per row)
ACTTCAAGACCAGCAAACATGTTCTGTTTGCGCTGATTGGCGCGTGGCGGTTCGCTAGCCAATCGCATCGCGTTGCGTCGCGCAAATGTATCCATGTTCT
CTCGCCACGTGCACATGCCCTTCCAACAGAGAAGAGACCCCCTACAGCAGAGAGAACATGGCTCCTCTCGCTCGAGAAGAAAGCGGCacctgcaattgca
gcactTCGCAATTCTCCCCCAAGGTTCCAACAAGGCCAAGCAAGTTCAGTGCAATGGGGGTCTCCGACAAATCCGATCTCCCGCTGTTGCAGTCGCGCAC
TAGtcaaacttcaacttcaccgTCACTGCTACGATCGACCTACGACAAGATCCGAGATGACCGCTACAAGCTGCTCTCCATTGGCTCTGTGATTGGTTGG
GTCGCATTGGGCAGCTTTATCAGCTCGGCGGTGCTGACATCCACGCAACCGCAACTGGTCGACTACACTCACGATGGTGTGTCAATGCACGCTGTTCAAA
ACCAACTCGACTTGATGGCAGCTTGCACCGACACTGGCAAGGGTGAAGGTGGCGTCGCCGAGATCCAAACCAACAAAGGTGCTGGATGGTTCCTCGGTGG
CAACGACCCCGAGCACATTctgacgtcgctgccggaAGTGACGTCGTTCGACGAATTGCCCGAAAATTGGGATTGGCGCGACTACAACGGAACGGGGATC
AGTCTCACCACCAGCGTCATGAACCAAATGGTGCCTCGCGCCTGTGGGTCCTGCTGGGCGTTCGCCACAGTCAGCTCACTGTCGGATCGGATTCGGATCG
CCCAGTTCAAGAAGACTGGGAAGCTTGACACCGAGACACTCCTGTCGCCGCAAGTTTTGCTGGATTGCGGGATGCGGTCGTTCGGCTCCTGCCATGGCGG
AGACCCCCGATACGCACACAAGTGGATTCACGAAAATGGAATTGTAGACTTGACGTGCAACCCGTACATTGCATCGCATCCGTCGTGGATGGGAGGAGGT
GACTGCGCTGCGACGCAATGCCACACGTGCAATCTGAAAGGCGAATGCTTCGTGTTGGAAGACCCTGTCAAGTACCGTATTTCGGAATACGGTACACTCA
ACTTCACAACGTCGGAGGAGTTCCAGTTGCAGGCGATGAACGAGATCTACCATCGTGGTCCAATTGTAGTGAGTATGTACTCGTTGACGCCCGAGTACCG
TCAGTTCAAGGGAGGTTATATTCTACGCGACTCGACTAAGTATCCCGGCACTACCCATGTTGTGAGTATCGTCGGGTGGGGCACCGATGACGAGACAGGA
GTGAAATACTGGATTGTCCGCAATTCGGATGGCACTAACTGGGGCGAccgcggcttcttcttggcagaGAGAGGTGTCAACATCTACAACATGGAGAGCC
ACGGCGCGTTTGCCGTTCCAATCGTGTAGAAGTCACAAACAAGTTACAAATGGGACTATCTCACAAAATTACGTTCTGGTCGGACTATTTACATTTCACA
AAAATCGTTAGACTAAAAAAAATATGCGCCTCACATTTTGAGCAAGTTGAtgtcgacgatgctgccTCGGTCGTGGAAAACTTCGTCGCGTGCAAGCGTC
AACTGCCGCTCTCTGAGCGTTTTGAGCGGCATCTCGGAAGACCTACTCGTTAGCACAAGTATCGGCCACCAAATCGGTGGGGACTCGCACGATGCGTTGG
TGGACAGTTTGGTCCGGACGAATGTAGTAGCGGCTGGTTCGCGACTGGAGGCGGCGTTGAGGCGTGTGGACCGTGGGGACTTCGTGGCGCCGGAATTCCG
AGCCTCAAGCGACCGATACGCCAATCGTCCACTGAAGATTGGCACAGTGGCTACAATTTCCactccgcagcagcacgcgcaggtGTTGGGACTTTTGGAG
CCGCATCTGCAGCCTGGAATGACGGCGGTGGACGTGGGTTGCGGCTCGGGGGTCCTCGTGGCTGCAATGGCTCACTTGGTGGGACCCTCGGGCTTCGTCA
CGGGGTTTGATATTGTCCCAGAGCTGGTGGAATTCTCGAAGGAGAACTTGCAACGCAGTCTGGGCAAAGCGGCAGCTGAGAAGCAGACGGAGATCATCGT
GAGTGCTGGAAAGAAAGACCTTGGGTTGCCGTCGGATGGTCGGTATGATTGTATCCACGTTGGTGTTGCGGTGGAGACCAAGGCGGAAGCGGAGAGCTTC
TTGGAGTATCTGAAGCCTGGTGGTGGGTTATTGATTCCGCTTGGAGGTGCGGGAACTGAGCAGAAGCTGGTTAAGGTGAGCTGTGTAGTAGTATGTGAAT
GAAGCATAAGGCGGTGATCTGACGTGCCATTTGGTGTACAGATGACTAAACTGGCTGATGGAATTGTGGACAAGCGAGACATGATGAGCGTCCTTTGCCA
GCCGATGCTGGACAGTGTCCCTGTGGAAGTTATTCAGGAAACTCGAGTTGAAAAATTGGCACGCGTGGAGAAAGCCCTTACCCAGTGGCGTGGAGATTTT
GAGGCTGCCAATGGACGGAAACCCACGCGAGACGATCTCATGAGTAACGCTGTGTCCAAAAAGCTTTTCCAAGAGTTTGCAGCATTGAGGAAGTAGACGG
AAGCATGATCGAGCTTAAGTTGCCAATTCAGTTAACGAGCTGGAGTTCAAGAGTATGGTGCTCACTTTCATTGCATGCAAACGGTGCATTGTCGGACCTG
TCACGCGTGGGCTGCTGCCTTGGTTTTCTGTAGGAGTTGTTCGGCCAGTTCGATCTGGTGAGTGATGTGCTCTCGCTGGGTCATTCTCGCGTATCGTGCT
GGGTTTTCGGGCGTCACGAATTGTGGTAGCGGCTCCACGACAGTGTCTCCGTTGGCGCCGTTAAAGCGCACAATGGACTGACGTTTCTTCTCCGAGTTAC
AAACGCGGTGCTGTGGCGTACGAACACAACATAAACCACGTTAGAATTCACCACATTTTGCCTGGAATCATCATTGCAACGTACCTCGGTTGCAACTAAA
ACACCGTTTGTCCAGTGCTCGAGCATGTCCCCAACCATGACGAACAGCCTATCGTGTGGAAAAAAGAGCTGGTGACATGATTGATCTTTCATCAAGTTGA
ATACAGCCTTTCGTACCTGTCATCGCACACAGGAGCTTCGACCCAATTTCCCTGGCGATTCATCAAGTGCAATCCTTCTCCATTCTGGTGGATGATAGTA
AAGCATTCAAAATCAGTGTGGGAGGCAATCCCCaccgtcgagttcttcgtcgGGGCGTCTGTCTCCGGGTACGTCAGTAGTCGCATGAAGGCctccgctt
cttcgtccacatGTTGCTGCAAATCCCCAAACAGCAAGGGTAAGTACAACTCCAAAACTGCAATTGCAAACCTCGTACCAGGAACGTGTCGGCTGGCAAT
CCAAGCATCTCTGCGAAACTTCGGAAGAGCACTGTCGACAGCTTGGTGGTCTCCTCGTACAGTCCGTACACTTCCTCTCGAAAGCGTGGCAGCTCCGCCG
GCCAGACGTTCGGGCCCAAACTCGACCCCTCCTTCACAAAGCTCTGCGGGAGCTCACGCGCCAGATCGAAGCCTTCCAAGTGTGAAACCACATCGGGTTG
GTACTGTAGCCATCCAACACAAGAATAGTCAGCAGTTGCCTTTATAATTTGACATACATTGCCATCGTACCGAAGGCTCCTCGAACATGGGCGTCCAGCC
TCGAGCATTGGGTGAGCGCTTGCAGTGGTATTTCTGCTTAACATCGTCAGGTAGCGCGATGAACTCGTCCGCTTGACGGTATGCCGCTTGAATCAGCTTA
CTGGGCATCACTCCCTCTGTAGGAATCGTGAAGAATCCCGTCTCGATGCAGGCATTACGCATGGCGTCCAGGatctgcgtcttggtctcGGCCGCCACTT
CGCGACCgttgttggcagcagctaCGAGCGGAGAAACGTCAACGAgcggcagctgctgcaacgccacCTTGGACGCCGTCATGACgcgcggcgacgagaa
gctaCGAGCACCCAGAGCCACTCGAGATGAAGGCCGGAGACGTGCACCAAACATGGCGATAGCTAGAATGATGCGCAGAATCGAAGTGTAGCtatccagc
ttcaacttgatgtGTGACACACTTAATACCTATCTTATGTCAAAACGACAGCATAGAGACTATCATACAGACTGTAGCATTTGTCCATAAAGCTCCTCAC
AAACTTCGGCATGTCGTACctctcgacgtcgacgcaTTTCAACAACTGGGTCTTCTCggcggaggagctggcgcgtgtgcggcgtctgcagcatgtGAAG
AGTAAGCGTGCGTTGCGTCTGGAGCGTGAGGAGGCCCAGAAGCCCGAAGCGCCAGCTGCAAAACCTCGCAAAGCGCGATCATTTGCTGCTTTGGTGCCGA
AGTCGTCGACTGCTGTGCGCGATTCCTTCGATTGGAatgacgaggtggacgtggAGTTATCAAcactggaggagacggaggagaaggccaatCTACAgct
gacgccgctgctggagttccTGGACCCGGAGCAAGAGgcgcttcttcgagctttctacgaggagaagatccaggaaagctgcagtgctcaGTTCTTGCGC
ACATCGGACAAGGTTAAGTGTTGCGCtatgctgctgttcaagaGGTTTTACCTGAGCAACAGTGTGATGGAGTTCCACCCGAAGTATCTCGTCCCGACAG
CCATTTACGTGGCTGGAAAAGTGGAGGAGCAGTACATGTCGGTGGATACAGTCGCAGATCAACTCCATGTGGACCACAAGTTCATCATCGGACACGAGAT
GATCTTGCTGGAAGGTGTGCGCTTCCAACTTATCATGTACCACCCGTTCCGAGCGTTGTTGGGGTTTTTGGACGACTTTCGAGCATTTGCCAAGCAGGTA
CTGAAGAAGGATCTGCCGGCGACGGTcctgcaaaagctgcacgCAAACTCGACAGCACTGCTGAATGATATGTTGCTTACAGATCTGCCCCTGCTGCACT
ACCCGTCGTatttggcgttggcggcgctgtggCATGTGACGGATGAAGtggcatccagcagcggagAAAAAGCTGGCGGGCTCACGAATGCTGATGTGCT
GGACTACGTCAAACGCAGCAAGTTCTCTAAAGATCAGCCAGTTGACGAGGTCTCAGGTCGGCTGACGGAGATTACACAAGCGTTCCAAGCGCTGAAAACA
GAAAAGGAGAATGGCGGTGAGGAGGCTGTGCTTCGTCGTGCCAAGCAAGTTAAGATTATctacaagaagctgaagcagttccacaaggacgacgagaaga
aagacaagaagaagaaaagcgacggcaagaagaaggacaagaagcgcaaggacGGATCCAAGGACGAtaagaagaaggtgaagaagcacaagaaagACAA
GGCTTAATTAAACGCACGCAGTCTCTAATGACTGTTAGTGTTCGATTCTCAAGACAATAGAGCTgaacgctgcagcgcaataTCATAGTACATAGGATTG
CTagtcgtccacctcctcggctgcgtcttcttcctcctcttcatcgtcgctaccttcttcctgctgctccgctGCAAGTTTTTCTCCTTTATCATAAAAA
AACGCATCCAATAATTAGGCCACCATTTAGCACAAGTCTACCAAGTTAAACTGCAACGTACTCAGAACCTCGACGATGGCGTGCTGCGTGCGTCTCTCCA
GTTTCCGCAGCATGGGCGCGATATCGCGCTCCATATCCCAATTTGCGCGTTTAGGCGCgaggttcagcagctcgtcttcgctctcgtcctcgctcTTAAC
GTCTTCCTCCTGAGCTTGCGCCACTTTCTCCACTAGGTCTTCTACCTTCTCGTCGGCTTGGTCGCCGTCGGTCACATTCGCGTCCTCCTGGTCCTTCGGT
TGCTTCTCCATGGGCTCATTCGCCTCGGGCTTCAATGCCTCAGCGACTAGCGCACCTGCCTCACCATTGCCACTCTCGCCGCGGTCTTTGCGGGCCTTGG
cctcacgcagcagcttcagccgcTTGGCGCGAGGCATCGCCTCATCCACATCTGGACCTGCCATTTCCAAAGTTGTCTTTATAAATGAATTTTGGGTTTT
GTAAACCCAAAATTCATTTAGAGACAGCTGGAATGAGCCATGTTAGCACAAGATGGAGGATGGTGTCACCGGTACTTGGTGCTGATGAAATGGAAAAGAG
GGTTGTGAAGCTGAATCCGCACCCATCCATGGAGCAGATCAGGCAGCGCTGGACAACGGTCGAGCATGCGCAGAATTATTATTGTTGTCTCCACGCCGTT
TTCCTGTCGGCAGGATCGAGCGCATtccaagatgcagcagaagcactATGAACTAAAGAATTGCAACTGTATATGAGACTTGAACACACAGCACTTCTTG
CTGTTCAAAGGTCAAAATGGCATTAGTCCTACATCTCCTCAACTGTAAATAAAGAAGAGCTGACCGACCGCGCGCTGCccaccatcgccaacgcGAAGAA
CCAAAGCACCGAGCTTTCACCCTGAGGTCTCGTCAGCCTTCAACCCTTGGAAACCGGACGGGACAGCAGCCGGTCGACTCCACCACTCGATGACTCTTGA
CCTTCCCTCGTCGCGACTCGCACTCTCGACACTCACGCAGCCGTCAAGCCAATAATACACCATATGAATAATGCAGAGCCTCCTCTGCTGCCACCAGGCG
AAGCCCCCTCTCCTTCCAAAGAAAGAGAGCAAACCTCGCGGCTCGAGCTTCGACCGACTGAGCCGGGCCCCCAGGCCACCAATCCAATCATCCACCGTAC
GCTTCACCAAATAGTCcaacttcctcctcttccaccaggtgaaggagacgcaCGCGTCGCGCTTGCATTGATTCCTGGGAGCCAGGTAGCAACAGAGGAA
CCCAAAGCCACCAGACCCGTCAGCTTCCCACTTCCACATCCTTTCCTCCCCCAGcttccatctcctcctcttctctcGCGTCGCTCCTGGTCGCCATCGT
CCCACCATTACCGTCGTCACCTCTTCGTCTTTCACTTCGGCAAGGGCAGAACGACTTCCACTTGGTCGACCCCTCCTTTACTTTGCAGCCTCCGACTGGC
GCAGGTGTGCAGAGCACAGTCCTTTGCGTCGGCAAGGCTTGTTGCAGCCCTCCATGGTGCAGCGCTTGCCGCCACCATGGGTAGCACACAGGCCTCCACC
ACGGTCGTTGCGCATGCAGCCTGGGACCTCGCACAGACGCGAGCCACCGTGAAGCGCGCAGTAGTCGCCACGCTGCGTGCCCTTGTCACACCCGTCGAAC
ATGCAGCGCTTGCCGCCACCGTGCGAGCGGCAGAAACCGCCGCCCTgcgagctgcgcgcgcagcCAGCGAACTGGCAACGCGGGCCTCCACCGTGGGCCT
TGCACAGGAAATTCGACTGCGCGGCCTTGTCGCATCcctcgtggctgcagcgcttgccTCCGCCGTGACGGATGCAGAGGTTGCCGCCCTGCGAGCTCTT
GTCGCATCCCTCGACAGCACAGCGacggccgccgccgtgcgAGATGCACAAACCattcgagcgcgagcgcttGTAGCAGCCCTCGCTCTTGCAGAGGCGA
CGGCTCTTGACTTCACCGGGCTTCATCATCTTGGGCGCCGCCATGTGGGGCTCTGGGCGACGCGGGGTCATCATGAGCTCCGAGTCCGTGAAGTCAGCCT
CCAGCGACTCCATGAGTCCGTCAATAGGCGAACCCGCAAGCACGTTCAGGTTCAAGATGCCGTCGTCCATCTCCACGGTCTGCTTGGACTTGTCCTCGGG
CGCGTCCACCAAAAAGCTGTACAGAATCGACATCTCCGTACCGTCAAAGCCGTCGTCCAAGTTCACGAGGTCGGGCTTGTCCTTGCCGACGTTCTCCAGG
TCGCCGGGCATCGagaagtccagcagctcctccagctcctgggCTTCGAAGTTGGGCTGAGCAGCGGCGCTCGTCTCGGGCTTCACCTCGGCGGGGGCCG
GGGCGGCCGCAAACTGGTCGCTGGGCAGCCCCATGCTCAAAAGATCCGTCGCGGGGGCGGTGTTCCCCCACGGCATCGCGGGCAGACTGCTGGTCTTCgg
gaaggacacgaagggCAGCGCCGGGGGCGGCGCTGCCATGCTCAGCATGTTCATGCCGTCGGCGCCGAAGCCCAGGTCTCCGGCGGCGGTCCAGGCGGGC
GCGCGGCCCGCGGCCTTGGTGTTCTgcgtcatcatcgccttgctgttgcttgcaGCGGGCTGGTAGCCAGCGAAGAGCGCGACGGCGGCCGGGCCCATGG
CGCCCAGCGAATCGCGTGACTCTATCGGCCGGCACATTCTCGGGCTAGCGGGGCCTCAATGGCGGTGGTCCTGTTTTCCTGTTcactctctctcttcttc
gcaCTTTGCGTTCTACGGGTCGCCAGCCGCCGCACAGAATTGTTTCCACGGGCCCTTGCTTGCTGGTCAAACGGGCTAGGGCAACGGCGCATTTTCGACG
AATCGTGTAGCGCCCAGATCGAGTCAGTGGGATGGGCAGAGGCTCGGGGAACCAACTTGACTTGGAAACTCTAAGGCCGCGCGACCACAAAGAAACCGCA
CCAATTTACGGGCCCACTGTGCTTTTATTGTTGGATACCGCTCCTCGTCGCAAGTTGGTATTGGCGAAAAGCATGCCGGCGATGTCGGCGATGTTCACCC
TATCTTGCTG