Description :
From Genome Similarity Track
Location :
Scaffold_173:62526- 66108
Transcript NameFunction/comments
Hyaar_Emoy2811862fat-free family protein
Hyaar_Emoy2811863fat-free family protein

Sequence
3582 bases(100 bases per row)
CAGCGATGGAGGATCACGGCTTAATGCGCATGCAGGAGCTGATGAGCAGCTACTATGGACTTAATGATCACGAGAGCAGAAAAGTTCAAGATCGGAGCAT
GGACTCGACTGGGTTTGATGCCCAGGTCTACGTCAAGGTGCGCCCGGGTTGTCAAAAATAGAAGTGTCAAAATGGATTCTGAGCTAAAAACCAAATCTGT
CATTTGTGTTAGGAGCTGTTAAAAACACATGGACTGAATGAACTGCTCGCAATTGATGACAAATTGATACGTGAGATCAAAGAGCTGGACACTGACATGC
AGATGCTCGTGTACGAGAACTATAGCAAATTCATTACTGCTACGGACACGATCCGCAAGATTAAGGTGAGGCAGGTTTTTGACAATATCAAGAAACTATG
TATCTTTGGACAAATAATTTGTATGGACAATGCAGAACAACGTTGCCACTATGGAGGACGATGTCGCACGAGTGGTCAAGAGCATGGACGTTATCACGGC
CAAGAGCGAGGGTATTGATGTGGCTTTGGCACCGCATCGCGCTAAAGTGGACAAACTCATTGGTGTGCGACGCTTGCTGAAGAAATTCGAGTTTATTTTC
GAGCTGCCTCAGAAGCTCAACATGTACGTTTTAGTGGGTCTATGCATTGGTAAGAAATGGAGAGCTGCTGAGTTTGTGGTGAAATGCAGTGCTGTCAAGC
AAAAGGAGTACACGAATGCTGTCAAGTATTATCTACTTGCGCGCCAGATTCTGCAGAGATACGAGCATATTTCGGCGTTTAAGGTGACACATTCTAGTTT
CTGCTTTGGTGATGATGTACCAGCGATTACAATATGGCTCTCTGGTTGCAGACAATTCAAGTAGAAACCGAAAAGCCCATCCAGCTACTTAAAAGTCTGC
TTAAGGAGCGAATGCGTGACACGACAATCGAGTCGGAGGAGGTAGAGCTGATTTGCTTTAGGATGGTTACGTTGGAGTTAACCTAAAAGCGTTCGTCGCT
GTGAACAGCTTTGCGAGACAGTGGAGCTACTACATCAACTGGATGCCTGCAACAACGAGATTCGAGGCCAGTTTGTCGCATGGCACCGCGCGTTCTTTAT
GCATGTGGTGGCAGAGTTTAAGGTACACAGTAGCATCACTGCTGCTTTCGTTCCTGAATGTAGCCGTTCATCTGTCCGATCGTTTTGCTTCCTCGCTACA
GACTCAACGCAAGGCTGGTTCAGTATTGGACTTCCTTCAACGATTCAACGCAGAAGTTTTATCGAAAATGAGTCGAGTGTTTTTGGCGTACAAGACTCAC
TTTACACCCGAGGCTGTTGCAAGCGAGAAGTCGTCACCTTCAAATACAGTCCAAGATAACTTGTTTCGGAACTTCGTGAAAGAACTAGCTGCGCTTTATC
TGGGTGAATGCGCTGTGCAGTTTCGTCGTCCGCACACAAATTTCGTGAGCTTACCACTTGTAGTAACTAGATGTTCGCCCTCTACTCACTTGGTTTTACC
CTTTTTTTGCTCCGTACAGAGATCAGCAGACGAAGTTCTCGATGGACCGCGTGGAGATCATCTCTCCTCCGACGTTGCCGAAAGCGAATACTTTATTTTC
ATGCGAGTGATGAAGCGCTTTGTGTCGCAAGTGGAGAATGTGGACAAAAGTATTCCGATGTGCGGACTAGCTAAGGGTGCTACTGAAATCGTGGAGAGCT
GCGTGCGCTACCAGATTGAGGTTGTGTTTCGGGCAGTACGCGAGAACACAAGGGAATTCTTTGTTACTTCCTACGAAAACGTGTGCGGTCTGGGACGAAG
CTCGCGCGAAGGTGGACAGAGCGTTCGACCATTAGCGCAGGAGTCAGCGAGGATATTTACGGACATGATGCAGAAAGTTCTGCAGCAAATGGGGCTCATG
GTGCAGACGGGCTTCTCGGTTCTCCCTGAGTTGAGTCAACTCTTCTGTGATTTAGTCCGGGTAAGATGAAAACATATTGTCTACCAGCAGCATAACTAGC
ACGGTCGATCTTAACGAGTCTTGCACGATGTTACGTTTTACCCAGGGTCAATTCTGTGTTTTCTTAAAGTGGTTCAACGTATCAGTGCTCCAGTACGCGG
AGCCCAAGCGTGCATTCGCTCAGCCAGATGCACCGTCTGAAACTCGATCTGAGGAAAAAAATATTGCGACGCTTCCGTGGTTGGAGCCCACTCCGCAGTT
TCTGCTGTTTCTGTCATGTTTGTGCCAAGACTTGTCAGCTGTGGGTATCAGTGAGTGTGCGCACAATGTTAGTGAGCGTTTGTCAGCCGTTTCACCACCG
TCGAGAACCGCCGAAAGTGGACCGATTTGCAGTTGGCGTGAAAGCCAGGAGGACGCAACATATATGATTGAAGTGACCCGTGAATCTTCTGCAGAGCTGC
TACGGGAAGTTGCAAAAATGTATGGTAACCAGCTGTGTACCATTATCTATAACGGAATGGCTGCTACGTCGTGGTCTGACATGGATGAGGAGCCAAGGAG
TGTACAGGAAATGATGGCTGTAGTTGTAGAGACCACTGCCCGTTTTGGGAAGGAAGTTGCTGTGGCACTCGGCGACGAGAGAAGTATTTTTATCGAGAAC
AACAGTGGCTCAAATGGCCGTGACTTCCGCCGGCGTGCCAGCGCACTGCGGTCTCGCAACGCAGGGGTTGCAGCAGCACCGTCGGGAATGCAGCTTAATG
TCGATCGGGTATTTGCGCGTAAAATCCATGCTTTTCCCTTCCAGCTTGACCTCACTGCAGACACATTCGTCGAGTCCATGCTGAAAATTTGTATCAAAGC
TTTCAGCGAGTGGGTGAGGTTGTTAGAACTGTCGAAATTCGGCTTGCAACAGATTCAACTCGACGCTGAATTTCTGCGCAGCACGCTGATGCATATCGTG
GTATCCCGAGAAGCCGAAAAGGAAATGGAAGACCTTTTGTCTGATATGCTTTCGAACGCACGTGCTCGAGCTGTTGAAGACACCCTCATGGACCAGGCCA
ATGTCGGTGTCATTGTTAGCGCTAAGAGTACCCAAGTGTTGTCACGCTGGCGGTAAAGCAGTGCGTGGTGGTAACGCTGACAAAAAGTCTGTTCATGGGC
ATCAGCGTGTTTGCAACTCGTTGACTACTGCACCCGTCGTTTCGGCATCTTGGATGGCGTACAGCTTTGGCAATCAGATATATGATCCGTGTGATGTACC
GTCAACAAGACCTTGAAGTGAACCAACGCATGGCATCGCCTCCGTCCCTGATCTCGATTAGATCCAAGTACGCCTCCGTATACTCGTACGCCAGGACATG
AGGTGACCAGTGGCGTAGTTATTGAGCTGCGCTGGTCGTCAACAAGAGTAACTGCGCGGAAAAGGTTATTGATTGTACATGTCTAGGATGTAGCGTGTGC
TCGGCTTTATTCTCGTTGTAGGAATAAAGAAATTGCATGTCCTCAGCCAAGTGCTGATGTGCACGGTGGCATTCGATTGGCACAGTTGCTGCATGAGTGA
TTATTCCGCCTTTTTCGAGCTTACTCGTTGCCCAACCTGCTGCTGACAATGAAATGATGTCTGAAATGGCCTCACATAATTT