Description :
From Genome Similarity Track
Location :
scaffold_66:62518- 63924
Transcript NameFunction/comments
Plaha_PHALS_04868pyruvate dehydrogenase (acetyl-transferring) e1 alpha subunit

Sequence
1406 bases(100 bases per row)
CACTGTCCAATCCTCCCACGTCAAACCTTTTAAGACGATGATGATCCGACGCTCTATCGCTTTGACTCGCAGCGCTACTAAAGCTactcgtgcgttcagc
gccGCTACCAACTCCTCAAATGAAGCAAAATTTGAGTTTTCAATGCCATTTGAGCTACACCGTACGTCGCCCTATTGATTATATAAAACACTGTTTTAAG
AACGATTTCAAGCCCGAAAATGATTCTTTGCAGGCCTGGAGCAGGGTCCACCCGAGTTTGCTGTGACGAATCGTGAAGAAATGCTGGATTATTATAATCT
CATGTACACGATGCGTCGCATGGAGATCACGAATGACAATGAGTACAAGGCGAGAACAATTCGTGGTTTCTGCCACTTGTATGACGGTCAGGAAGCCGTT
GCGACAGGTGTGGAAGCTGCTCTTGACCGCAATGACTCGTGGATTACTTCGTACCGAAACCATTGCATTATGCTCGCCCGTGGTGGTACAGTTAAAGATA
TTCTAGCTGAGCTGTTCGGCATGGCATCTGGTGCCACTGGTGGCAAGGGGGGCTCCATGCACTTTTACAATAAAAAGGCTAACTTTTATGGTGGCCAAGG
AATTGTTGGTGCTCAAGTACCCGTTGGCGCGGGTCTAGCTTTTGCTAGCAAGTACAACCACAAGGGCGATGGCCCGATGCCATGCGCTATCACCATGTTT
GGTGACGGTGCCGCAAATCAGGGCCAAGTCTTTGAAGCTGCTAATATGGCTGCTTTATGGAAGCTTCCCGTAATTTTCTGCATCGAAAACAACCAGTACG
GTATGGGCACCTCTACTAAGCGTTCGTCTAATAATACGGATTACTACACTCTGGGTAACAAGATTCCTGGTATCAAGTGTGACGGTAATGACGTACTTGC
TGTGCGAGAGTGCACAAAATTCATGAAGAAGTGGTGTGGCGAGGGAAATGGACCGATCTTTGTCGAGATGAATACTTACCGTTATCATGGCCACTCCATG
TCGGACCCTGGTGTGACGTATCGTAACCGCGATGAAATTTCGCAAATGCGCGCCTCACGAGACCCAATAGAGATGGTAAAGAAGCGTATGATCGAAGCTG
AACTCGCCACAGCAGACGAGATCAAGGAAATAGAGAAGAAGGTGCGTGCCGAAGTTGTCAAGGCAACCAAGGATGCCAAGGCCGCAGGCAAGCCCCATGA
GAGTGCGGCTTTCACGGACGTGTACACGGACGGCAAGGGCAACAATGCGTACCCGCCGTTTATTCGATTCCCTGACTACACTAAAAGTTTGTACAAAGGT
AAACCTATGCAGTAATTGTGAAAACAACAAGAGGGGCGCAGATACGGCTGAATTTTTTCTGGTAAATTGCCTTTACGAGCGTTAAATGGTGCTGCATAAC
GCCGTG