Description :
From Genome Similarity Track
Location :
Scaffold_3:62513- 65344
Sequence
2831 bases(100 bases per row)
GCACAGCAACTGGCTGCTGTGAGCTCACCACTTCATGTATCTTTAACTGCACTGGGCTGTAGCTTACTTTGGTATGCTACAACACATCCACCAAGTGTTA
CAACTTGGCCAGTAACAGATCGACGAGTGTCCATATCATTGCCGAGGTCAGCATCAGCATATCCAACGATAGAAAGATTGCCCTTTGCAGAAACGTTTGG
TAGCACCAATCCATAGGAACTAGTCCCCTTCAAATACGTAAGAGCGCGTTGAGCCAGTCCAAAATGTTCCTCTGTATAACAGTCAAGAAACTTGCTCAAG
ACACGAACCGTGTTCGCGATATCGGGTCGCGTACAGCGCACCAAATACTGTAGGGAACCAACAATTTGACGAAATGGTAGATCACTTCTGTTTACGTCAG
GTCCGTAGGGTTTGCTGGGTCTCACAGGTTTTACTTTTGGGTCCATTGGAGTACGGACCACACGAGCAGTGTGATCGCCATATTTTTCCACAATGTGTTG
AATGTACGATTCTTGTGACAACGTGACTCGTGTCGGCTCCACTTTTACATTCATGGCCAGCAAGAGGTTGATCTCCCCCAAATCCTTTAGCTTAAATTCA
CTCTTCAACTGTGAAATTAGCCACGTGATACTCTCATTTTTCGCCGCAATAACGACATCATCAACGTAGACTGTAAGGAAGATAGGAGAGTCGTCGACCC
ACTTGACGTAAACGCCATCTGCAATTATGCTGGATATGAAACCAAGCTTCACAAGATATCTCTTCAAAGTTGCGTTCCAGATCAGAGGAGCCTGCTTTAA
GCCATATAAGCTCTTCTTCAACAAGCACACACGTCCAGTGCCATCGTCGAACAACTCTGGTTGCTCCATATACACGTCGACATCAATCTCACCGTTTAGA
AATGCCGTAGTGAAGTCAATTTGGCGAGGTTCCAGGTCATAGTAGAATGCGAGCACAATGACAACACGGATTGCCTCCATGCTCACAACTGGAGAGTATA
CTTCCCAATAGTCTGAGCCAAACACTTGCTCGAAACCCCGGAGAGTAAGTCGAGCTTTGTAGCGTAAAATTTCTCCGTTTTGATTCCTTTTGATGACAAA
CACCCAGCGACTGGTCATGATCTTAGTGTCCGACGGACGGTTCACTAAAATCCACGTATGATTCGCTTGTATGTCAGAGAATTCCGTTTGCAAAGCTTGC
CACCACTTATTACCATCAGGACCTGCAAGCGCTGCACGAACTGACTTGGGCAGCTTGTCCGTAGTTGAGATGAAGTAATTGGCAAGCGAATAGCCATGTA
GCCTTACGTTTGGACGACGTGTACGTGTTGATCTGCGAAGCGTAACAATTGGGTCTTTGGTGTGTGTTTTCCGACGTCGCTTAACTTCAACCAAACCCGG
TTGTCGCTTCTTTTCAACGTGTTTTGTACATCTCGTATCATTCTCATGTCCATCGACACGAATTGTAGAAGTGGAGTCACAATTTGGAGTATCATAAGTC
TGGGCCAGCTCCCCTGTTCGTCTGCGTTTTGTTAGACCTGAGTTGATATTATCAAACTCAAGCTCCCCCGCTCTTCTAACTTTTGTCTCTTCCACTACAT
CGCCTCCAACCTTAGCATCCAAAGGACCGACTTCATCGGAGCTATGCAATGCCAGTGCAGTTTCATCGCTGCTACAGGAGCTCGAGTAGTCATGAAGAGG
AAGTCTTACATACGGGATTGAAACAGGTAGCACCACACCGGGCTTCTTCGCGTAGAGCTTGTCAAGCAACTGATCCACATAATCAGCCGCCACTGTCCAC
TGATCGCGAAACGTTACGTCACGAGACTCCACAATGTGTCCGGTAACAAGATCGAGGACACGATATCCAGTCGTGGATTTTGGATATCCTAGAAATAATG
CCTCTTTCGCTGTCGTATCTTGTTTACCTTTCCGTCTTTGCTGAGGGACGAAGTACGTTGCAGCACAGCCCCACACACGTAGACCAGATACATCGGGTAT
ACGACCTTCAAATAACTCGTAAGGTGTACTGCCTTTAATGGCTTTGGATGGTGAGAAGTTGCGTATTGTTACCACAAACTTGAATGCCTCTCCCCATAGT
TTTGTTGGAGGTCCACTGGTTACGAGGAGAGCGCGAACGGATCGCAGTACTACACCATTCATCTTTTCGACGAGACTGTTTTCCTCCGAGTGTATACGTA
TTTGTATACAGCGGACGAACTCCATTGTCTCGGAGGACTTGTTGTAGCTTTTAATTTACGAACTCAGTTCCTTGATCAGACCCCAGGAATCTGACAGGTC
GCTCACATTGCTTCAGCTGTAAGACCAACGTCTTCAAGTTGTCTGTACATTGAGACTTTTGACGGAGTAAGAAGCCCCATAGGTATCGTGAGTATTCATC
CTCCACGAGCTGAAACATCACGTTTCCAGCAACCGAAACCTCACCATAGTGACAGACATCGGTCATTAGTTTTTCACAACACCTCATTGATCGACATGGA
GACACGTTCTTGTATGACATTCTTCGCGATTTTGCTAATGTACAGCTTAGGCAATCCATCGCATCTCTAGTGCGCTCACTAGGAGAGATCGTCATGCCTG
TAACCATCTGATCACGATGGAGCTGCTGCAATGCTGCAAAATTCACATGACCAAAGCGAAGATGCCACCGAAATATCGATTCACCTCCAGCCACAAATGA
TGCAACAACTTGAGGTGAATTACACAAACCACGAGTGCGATAGTAACCTCGACTCTTGACAAACACTATTGCTGTCGGCCCCTTCCATAACAGCCGTCTT
GGAGGTCCGTCCTGAGGATACTGTGACTCAC