Description :
From Genome Similarity Track
Location :
Scaffold_26:625087- 627867
Transcript NameFunction/comments
Phyca_LT1534567797Hypothetical protein
Phyca_LT153450729240S ribosomal protein S2

Sequence
2780 bases(100 bases per row)
gcccccacaggcataaactttatcgcattttcccagtgtctggccttctgccaggccacaatggcgcatctcgtgtaagcagtaatggcagtcgatcctt
cgttgccggtgaatcctccatgtttaattctcttttcgtatttgtcccatagctcagagaaagtttcttggttcgggttcaggaagttaaactttacaat
tgacttgcaatccttgtcacctttatcgtccttgttgtcaaccttttcaaccttcccaaggagatccccggttgtcgtataccacgtactgatatcgtag
tggccttccaaagtagaatcatacccgtcttcatacgtcctgacttcatgttgtaactgcacgatgaagaatttgagtttgttgtcattcgaaacaagtg
catttgctccttccagggcataaaatctcgcgttgtcgaccccttttagtgccccagacccaaggttccgaatactattcaccgtgtactcatgttccaa
aagcagtgcaaacgaatcgttatctgctcccattttcgagattccagttgccaaatcttcactcaaacgctgatcttggtgtttttccaagtgccgcatt
gtcgacggtaaacagacggagtacactaacgcaagacgatatcctttctccacgttctccaacgcatgctcagcatcggcatagtgtacagcataatgag
gaaggaacgcagatgtaccatcatttttgccaaagtcatgacggtacttctcttctccgtctcggtacaccaccagatcgccaccttcgtgatcacttgg
cggctgcactaccaacgttgcaatcattccgtccttcttctccgtgtcttggtgtttcacaaaatggcctccttcactgtatacgagaagtttgtacaga
acacactcgagtgggatgcctcgataccccagccgatcggcaacgaccttactcagcttctcgatcccagctttccacagtgggttcttgaattgaacga
gatctggttctagctgccaacttttgcgaacagcttcgtccatcttcgtgtccatgttgtggccgaaaggagacttttcacacaaagcaatcagcggagt
gacaatttcagtacgtagcggagtcggaatgagtcccaaactatcaacaaatagcccaggctgggatggtagagtgttagcttgtccaccgaaggagtac
tctcctgcatagacatctgctcgagcaaggattttgttaacttcgactgggccttctcccacgggggccatgacatcgtctaaacttcctttaccaccaa
aaggccacttctcttcgaaataagggtccgccatcgtatcaaaaattggataatgacagtcctgcaaaaatcctttgctcaactggcaggtcgttttata
tcagagcgaatacttcttgggcgtattttccgtctttgtatcagatttgtttacaggaaaagatgaaacaaattcctctgctaaaatgaaagaaaattac
ttgggtgtcttggtacacatggaacgcttccgtcgttttaactatcccttaggacagggaagagcccgctggggataactcatattttcaggagggggct
tgtaagtgggggccagccgaactagacaaagtcttctcgacgacggcgttcccattgtgttgtttggatgacacaagttgcgttgtgtcacacaacgcaa
ggcaatttataaattacaaatcaacctgtacgtatttttttatattgctatattttagtactgtattacatcgtgttataaatatttgtagtactgtagg
tcatcagcatttcacgaattaatataatcatttgcattaatagtattatttgtattaataatacaagtagtctcacaaattgctttttatttcaagaaaa
gcatttttgaatagcttgctttacctctcacttttagagatggagtgccaggaagaatcggctgggtactggaaaggactgtggcatggccttctgctga
tgctgcccgtgctcaccttcctctatcgcaagtggacggtggcggccgagcgatcggcggtgcaacagccagtgctcgggtactttccctaattatgatg
cacggtgcattaaacagtgtttaataaacacctaacgtttttgttttctttcctgtatttgtttaacagaacgtacgcagtcttttcttactgagagaca
atttcggcagtttattttactcatggccatttactgcaggtcattcatgaacgagctgttcgcgttcgaggtggtgatggtcgcaggtgcggaactcaaa
gctgtgcgtgaccagcttaaggccgccgaagaggccacgccagtgaacgacaagaaggtgcaggcgcttaaggaacgcgtcgtcgacgtagccactgtct
tgcagaagaaactcgagactatcactcccatcgtgtccttcctgctagagcaaagtgtaggtgtgatcaaggaccaccactctgacaagacagacgacaa
tgaagctaaaaaggataaataatcgcgtacatatcctgaagtacattcacatagcacaagctctctacagtgtagttcgctttcgtaatagattccagcg
tttctggcgacaaaaggcttcgtatagtttcgattcacatacacggatcaagaccacagcttctacatgtagtagtatcaaaccataaaaggataagacc
aaattactgttgaagaagacgcgtttgttttctttgcattaaagccgcccagggtcgacacctacgcaccgtagcgtcgc