Description :
From Genome Similarity Track
Location :
contig_10:6248- 9611
Sequence
3363 bases(100 bases per row)
CAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGA
TTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGG
AGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCT
TGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGC
ACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAG
TACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTC
TTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTG
ATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAA
ATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAG
CCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCC
ATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTG
ATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTT
CAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAA
CACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGA
ATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGC
CAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTC
CGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCAT
GGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGA
GAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGA
GAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTT
CTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCG
AACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCA
TATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGAC
CCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAATACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGC
TCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCCGTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAAT
CCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGTACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCA
TATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCA
CTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGG
AAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCC
TACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTAAACCCTAACCTAAACCCTAAAGTCTACTTGCTAAACCCTAC
TATGCAAACCCTTTTTACAAACCCTATTTTCACAAAAATGACAATTACCAAATTTATCAACACAAAATTACAATCTTTTCTTTTCTTCTACTACTCACAT
TACACACATATTGCACCTTTCACATATACTTCCACCTTTTTACCATCTCCATATCACTTCAATTTACTTTTTCTATCTTTACACACTTTAAATGCAATAC
TCCTACATACACTTTCCCCAATTATCGCATCCCCACCTATTCCACTTTCATCACACTGCACATCAACACCTTTCTTACTCTCTATAACCACCACCCCATA
CTTCTTTCTCATTCACTTACTATATATATCTACCCATTCTACTTCTACATACTCTTCATATAC