Description :
From Genome Similarity Track
Location :
Scaffold_11:624578- 628906
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004954Similar to PE_PGRS54: Uncharacterized PE-PGRS family protein PE_PGRS54 (Mycobacterium tuberculosis)

Sequence
4328 bases(100 bases per row)
GGTACTCGATCCTTCGCCTGCCAAAATTGTCACATCCCCGCCGAGTTTCGTGCCATCCCCACCGGCTATTGCGACGGAGCCTCCAACACCACCGGTATCT
GTACTGCCACCGCCTGATATTGAGACTCTGCCTCCTTCAGGTGCATCCCCAGTGCCGACGTTGATGGTCACATGTCCGCCGTGTCCGCTTGTTGCGTTCG
AAGTAAAGATAGTCACAGAACCAGAGGAACCGCTACTGGACTCTCCTGAGGACACCTGTATTTCTCCTGTGGAACTGGACGTCGATGTTACTACTGAGAC
ATCGCCACTTGTACCTTGCTCCCCGTGTCCACTTGAAATCGTTATACTGCCGCCGAGTAAATTGGAGCTGTTACCTCCTACTAGGTCTATGGAACCTCCA
CTTTGAGAGCCAGTACCTCCGAGTACAGAAACAGTACCACCAAACCCGAGTTCGTTGACAGTACTTCCAGCGCGCAATGTAATTCCACCGCTTTCGCGAG
TAGTACCGGTACCAACTGCAAGAGTTATAGATCCGCCCTGTCCACCAGTTGCATTTGAAGTTCGCATGTCCATCACACCGGAACTGCCTTCAGTAGATAC
ACCCGTCGAAAAGCTCATTGGTCCACTGTTTTGCTTTGAACCTGATGACGCAGTTAAGAACTTGATCTCTCCACTAGCTGCTTCAGCCCCGCTCCCACTG
GCAATGATGACACGACCACCAGCAACGTTCCCTGTACCGGCCTCAAGAGAAACATCACCGCCTGCCATTGTTCCAGAACCAGCAGTCATCGAGATAATCC
CGCCCACTCCATTTGGGTCAGAACTATTGGCTCCACTGAAGTGAAGCTCCCCACTTGCTTGAGAGTCGCCAGAACCAACGCTGATGTCGATTGAGCCACC
CTTACCGGACGAAGCATCAGATGTCGAGATCAAAATATGACCCGAATCCCCTCCACTTGATACTCCAGACGAAAACGTAAGCGAGCCACTCGTTTTCATG
AGTCCAGACGCCGCCGATCCGATCAGTATATCCCCACTTCTAGCAGTATCACCTGTACCACTTTCAACTTGGACATCACCACCTTTAAATGTGTCGCCTT
GTCCACCACATAGTATAATTTCACCTCCAGCTTTCGATCCAGCGCCACCTTGAAGCGACACTACACCTCCGGTTCCATTAATGTTCATTGCCAATCCAGC
ATTAATGCTGGCTGTACCGCCAGACGTATCGTCACCAAGTCCCACACTTAGAGAAATAGATCCGCCTTGACCTTTGCTGGCATCGGACGTCACAATGCTA
ACATTACCAGACGAGCCTCCGTTGGACATACCTGATGATATCTTCACACTCCCGCTTGTCTGATCAGTACCAGATTCTGCAGACGAGATAGAAATGCCCC
CGCTAGTAGCAGCAGAACCAGATCCACTGAGAACGGTAATATTGCCACCTTTTCCTTGGTCACCGATGCCTCCATACAAATCCACATTGCCTCCATCATT
TGTTCCACGACCACTGGACAATCGAATTGAGCCGCCAACACCGCCTGCGACAGCACTATTTCCAGCTGTGAGCTCAATCGCACCTCCTTCCGGAACTTTT
GCAGAGCCAACCATAATCTCAATTAGTCCTCCTTTTCCAGATGTTGCATCGGATGTGCGAATATCAATGCTTCCAGAATCTCCCATGGTAGATTTCCCAG
TCCAAACTTGAATATTCCCACTAGATTGTAAATATCCGGAGTCTGCTGTTGATATTGCTACGTCACCACTTTTCACAACAGGGCCGCTCCCACTGGTGAG
AAGGACGTCTCCTCCAACTTGACCAGTTCCGTCGCCTCCAGAGATCTCAACATTGCCGCCGGATACTCCGGTAGCACCATTGATTGCAATGTCACCACCA
ACACCAGCCGTATTAGTCGAGTCACCGCCGCGTATGTTCACTGCACCACCAACGTCGTCATCACCGGGGCCGACTGTCAATACGATTGATCCCCCTTGGC
CTTTCTGAGTTGATGCCGTTTTTATTAAAATTGAGCCGGAGTTTTCGTTGCTTGAATTTCCTGACATAATTGAGATTGAGCCGCTTCTTTGACCTTCCCC
AGATTCTGCAGACAAAATCGACAGATCGCCGCTGGCTGCACTATCTCCACCGCCGCTTGTGACGATAACGCTCCCACCATGTCCACTACTTGAAGTACCA
CCATGCAGCAACAGATCACCTCCTTTATTTGAGCCTGAACCACCAACAATCGACACAGCGCCTCCTACTCCATTCGTGTGCGTACTCGATCCAGCAGCTA
TGCTCATATTACCACCATCACGAACGTCTCCGGAACCGACGCGTACAGCGATAACTCCACCTTGTCCACTTGTAGCAGCAGCTGTAGCAATTGTAATATT
GCCTGAATCGCCTCGATTTGCAACTCCAGTTGACAAAAACACATTCCCGCTGGCTTGAGTACGACCTGATGAAGCCGTAGAAATTGCAATTTCTCCACTA
GATCTGTCGCTGTTGCCACTAGAAATGCCAACATTCCCTCCTTGAGCCTCAGTTCCTTCACCTGCCGATAAAGTAACATCGCCGCCGTAGCTTGCACCAG
TGCCACTAACAAATGAAATGCTTCCTCCTTTTCCACTTGGATGCGTGCTTTGGCCTCCATCTATGTAGATAGAGCCCGCCTTGTCATCGTCTCCCGATCC
AGCGCTCAATGCGATTGATCCGCTTTTCCCGCCTTCAGCATTTGACGTCAAAATGGATGCATCTCCGGAATCTCCTCCAAATGCAGCTCCTGTTGAAACC
GAAAATGAACCACTTGTTTGCTTTGCGCGGGAGATAGCAGTTGCAATTGAAATATCACCACTAGATGCGGTTGGCCCATATCCACTCAGAACTCGAACAT
TACCGCCCTGTGTGTCTTTGGCTGCGCCACCGATGACTTCAACATCGCCTCCAAGATGCGTTCCATCACCTCCACTTAGAACAACGCTTCCGCCGACGCC
ATCTGCGTGAGTGCTATTCCCTGCAGTAAATGCAACTCTGCCTCCATTCGCAGTATCACCAGTTCCCACATGAATGTTGATTGAGCCAGCTCTTCCGTTG
GTTGCAACTGACGTCAACATGTTGATTACACCAGAATTTCCGTTACTTGAGTCTCCAGAGGATAACGTCAACGATCCGCTCGCACTTGAAGAACCAGAGG
AAGCGCTGCCAATGACCACATCTCCACTCAATCCATGATCACCAGTGCCACTTGTAACATGAACTGCACCTCCTTGCAAACCATTGCCGATCCCACCGGA
TATATCAACGTCCTCACCAGCATCTGGACTTGATCCCCCGGACAACGAAACACTACCACCAGTAGCTTTTGCAAAAGTAGCAGCACCGGCAGCAATGTTG
ATCTTGCCTCCATCACCAGCACCACTGGAACCGACAGAAAGCGATATAGAACCACCTGCGCTTTGTTCAGATTGTAGCGTACCAAGTGACAAATTACCAG
ATTTTCCCGCAATCGCAGACCCAGTATTGATCCGAATTGTACCAGATTCGCCTGCCTTGGCATTACCGGACTCAATGTTGACATCACCTGACATGCCGTT
ACTCCCCTCACCTGTTTGCAGTTGAAGGGTCCCAGAGGTTGCAGCGTCTGCGGCAACGCCAGACGAGCTCAATCGAATGCCTCCAGAGGAAGAGTGAGCG
CTCGTTCCTGAGGTTAGAGATATCTCGCCACCAGGAAGATACACCGAGTCTCCTGAGCGGATGGTAACATCGGAGCCACGCTTGTTGTTTTGGCTACCTG
CAGTCAACGCCACTTGCTTTGCTGATTCGATTCGGACGTCATCAACTTCAGAAGAAATTGTGGTCGTCTGACCCAAAAGCTGGACTCCGACATGATCAAC
TTTAATTCTACCACTCGAAACTCCACTTTCAACGGTCGAGAAGATCAAATCGGTCGTATTGACGTCACCCACTTTCGAAGCAACCACATCGATACTGGCA
CCAGCTTGAACCTCGGCGTTGCCTTTGACGTGCAGCAAAATCCCGGTACCGATGCCATCAATTTGGACCGGCAGATCATCATATGTTGGGCCCGCGTAAG
GGCGATCGATAAAGAACTGAGTCGAGCTGATCGGTCGTTTCGGGTCAATCAAATACGACGCCCCCGCAAGTCGCACGAACTGACTGGCACTGAGTTCAGC
CGATAAATCGACCAATGTCGTCACTGTATTGCTGCCATGCACAACAGAGACATTGCCAGGTAGCACGAGAGCTTGCGCAGTGCTTGCATCTGCGAAATGT
CGGATCTGGAATGATCGATGAGAAGTGC