Description :
From Genome Similarity Track
Location :
Scaffold_13:62431- 63859
Transcript NameFunction/comments
Aphas_H257_05669acetyl-CoA carboxylase

Sequence
1428 bases(100 bases per row)
ACGGCCACGAAGGAGAAGCTCTTTGACAAGGTACTCATTGCGAACCGCGGTGAAATCGCCTGCCGTGTCATCCGCACGTGCCGCCGTCTCGGTATGTGTG
TCTTTGTCATCTTCACTGCAATTCATCCCAACCTCATGTCTCATGGATCTACAGGAATCAAGACGGTGGCAGTGTATTCGGAACCTGATGTAAACTCTGT
GCACGTTCGGCTTGCAGACGAAGCCGTGTGCGTCGGGTACGTTGTCATCCACCATTCTTCGTTGCTCATGCCGCTGGCGCTAGTCCTGCCAAGTCTGCGA
ACAGCTACCTCAACATTGACCGCATCATGGATGCTGTCCGTCAAACTGGCGCGCAAGCGGTACGTCCGTCATCCTTCCCAAGCAAGTCGTCTAAATGGGG
TACGATCGATAGGTGCACCCGGGGTATGGCTTTTTATCAGAGAACAAATTGTTTTGCGACGCATTGGACAAGGCCGGCGTGACCTTTATCGGTCCTGGGT
TCCATGCCATCGAAGCTATGGGGGACAAGATCGAATCCAAGCAAATTGCCATCGATGCCGGTGTACGGACAACCGTTCATATCCATCAAGCGGAATTCCT
CCTCATTTCGTACACAGGTCAACACGATTCCGGGGTTTCAAGGCGTCATCCAGGACGAAGACGAAGCCGTCAAGGTGGCCCGTGAGGTCGGATACCCTGG
TACATCCCCATCTTCGTTCTTGTACACCAAAGCTTAACCATTCGGCGTAGTCATGGTCAAGGCGAGCGCGGGCGGTGGCGGCAAGGGCATGCGCGTGGCG
TACAACGACGCCGAAGTGCGCGAAGGGTACCGTTTGTCCAAGGAGGAAGCGGCCAACTCGTTTGGCGACGACCGCATGTTCATCGAAAAGTTCATCGAAG
ACCCGCGACACATTGAAATCCAGCTGCTCGCCGACACCCACGGCAACTACGTGCCCTTCCCCGAGCGAGAATGCTCCATCCAACGCCGCAACCAAAAGGT
GATCGAGGAAGCGCCCAGTATGCTCTTGGACGAAGCCACGCGCCGCGCCATGGGGTACGATATGCCTACTCGATATTTTTATATACTTTGTACTGAATTT
TGTATGTCAAGAGGGACTTGCTTGGTATCACACTAATTGAAATCACACACTAATTTTACGTTGTTGATGGTTTCCTGCAACCTGATTGGCTAAAATTATT
TTGCCGATAATTCTTGTCACTCCAGTTTAGAATAAGCACACAACAATACTACTTTAAGAGTCTTTTTATCTATCTTTTTATATATATGCTGATGCTGTTG
TTGTTATTCAGGGCTCAAGCAGTGATGCTGGCCAAGAAGGTCGGGTACACGTCGGCAGGAACGGTGGAATTCCTCTGTGATAAGCACAAGAACTTTTATT
TCTTGGAAATGAACACGCGGCTGCAGGT