Description :
From Genome Similarity Track
Location :
Scaffold_349:6242- 8112
Sequence
1870 bases(100 bases per row)
GGCCTTTCGGGTCGTCGATCTGCTCTGGCCGCACGATCACCATGACAGGATCTTGACGCAAGAAGTCTCGCAGTTCCTTCAAGTGATACTGACGATCCAG
GTCAGCCTCGGACCAGTCGAGCGCCGACGGTCTGGGATCTTCGTCGTCCAAGCCTGGCGTCTCTCAGCTTCTTCCTCACGATCTGGGCCTTGTCCGCGAT
CGCGTCCAGGTAGTCCGGATCGAGCCTGCTCGGCGAGTCAGCGAACGCGTATCGGTCCGATCCCGCCTTAGTTTGTTTTGTTAGTGAATCTCGGCTCGCA
CCAAGCTCCACCGGGGTCCCCGAAGGAACCTGGGGAGGGTGTTGAGGTTTGTCGTCTAGATCTGTCTCCTGAACGCCCTCGATTCCGTCGACAGAAGTCC
TCCGAGCACTCTGTCGATCCGCGGATCTCGTTTTGTTCAGCAGCGTCTTCGTCGATCCGATATCCGACAACACCTCTTCCCCTGGTTCTTTCTTCACTTG
CGCATCTTCTACGGACTCACGGTGAAATCCGGAGTCCCCAAGAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCGGCCAAAATCTGGTTAAGGC
CTGATCGGGCTTCCCACGAGCGCCCAGACACCGACTAACGGAGGGGGTTCCCCAACGATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCG
GCGGGCTGGATCTGCTCTCTCGGGGCTCCGAAGATGCAGCACTTGGTGAAGATCGAGTGTCTTGGCGTGACGCGGGGATAGTTTGTGGAGCAGCGCGGTA
GGCTTCGCTCTACGTCCGAGTATACGCTCCGATCGAGGATTGTTCGCTGCGATCGGTCGGCCTGGAGTTGATCCAAGGCCTGTAGTTGCCTTTCCGGGTG
TGTTCTTTCCTTTCCTGAGCTGCTTGGCGCTTCCTATAGCGGGATCGAGGTTGATCGAGAGGAGAAACGATCGCCGGCCAAGCACTAATATCCGGTCGAT
CGGGGACTTGCCCACAAGAGATAGATCACTAGAGTAGGTCAAGCTGGCCAATGTATTAATCCAGTCTTAACCGTACCGCTAGTTCACTACCCAAAGTGTC
GACACTGCCGAGGCCAATGTAGTTCCTGGGACTTGGTGACTTGAGGGGACTTGTGGTCTTTGGTGCAAATTCTCTTCTGATTTAGGTTTAGCTGGTGTCT
CTCTACCGCTACCATCTCATCTACCATCCTACAACTCCACAACCACTGGATTCTTGTCCTGACTTCGTCCTCCATGTGCATCCCATCGTGGTTGATCCCC
GATCCACGATCAACCCACGATCGGCTCCCGATCCACGATCGACTCCTGATCTGCGATCGACTCCCGATCGGCGATCGGCGATCAACTCCCGATCGACGAC
TCGTGCCGGTTGCCGTACGCCGCCGATCCATCATCTTCTGTCCTCGGCCATCCTAGATCTGCGAGATCTGTCGTCGATCGGGGCTTGGGTCGACCCCGAA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN