Description :
From Genome Similarity Track
Location :
Scaffold_18:624128- 626152
Sequence
2024 bases(100 bases per row)
CCGTCAACACACACCGGGACCAGCTCAACATTAACGCCGCTAAGATAGACATCCGCTGGTTGGCGAACTGGTTTCGAATGTTCGCCAAGCCTCCGGTAGA
CGTCGTCCCGGTTAGAGCTCGAACGCAGAAGACGGTTGACGGAGCGGTCCGCAAGCAATATACTGACGAGAACTATACGCTGCTCCCTGCCTACTTCACC
TGGGACCAACTCTACAATGAGATGCACAACTACGTGGTGGAGAACGACTTGGAGGTGAGGAAACCTCGACCATCAACTTTCCGACAGCTTTTACAGAAAC
ATTGTCCCGTCATTCGAATCCGATCTCCTCGCAGCAACGTGTGCGACTTCTGTTCTATATTGTACGTACGTATGCGCTCTCGGGTCACTGTAGAACTCAC
CGAAGAGCTTGGTGTTCACACTGCCGCAGCTAAAGCTATGAGGTTTGTACACAAGAATCATTCTGCTTCACCAAGGATTCTAAGATCATTCTGATTTACT
ATGAACTTTTATATAGGTTAGAGTACCAGAACGACTTGCAAGCAGTTTCCGATGAACATGCTGTGATTGTGATGGACTTCAGTCAAAATTTGACACTGCC
AAGTGTGACGTCTACGCCTTCCGAATGATATTTCCTGTCTTTGATCAACGTGAACGTATTTGACATCTGTTATGCCAACAAAGGCATTCAATACAATTAC
GTCTACGACGAGTCGGTGGCGGGTAAAGGCAGTGACGAGGTGAACAGCATGATGTATCACTTTGTTCACCGAATTGTGCTTGGCAATGGACATCGAAACC
TTACAATTTACGCCGACAACTGTGAAGGCCAGAACAAAAACAACTTCATCATCAAGATGCTGCTAGCACTAACTCAAATTGGTAATCTGGAGACTATTGA
TTTTAAATTCTTTGTAAAAGGACACACCAAAAATGCTGTCGATCGCGGCTTCGGGCACATGAGAAAGAAATTTGCGAAGGAGGACGTTTGGACTACGGAT
CAGCTGTTGGAAGTGATCAATGCGTCTTCCATAAGCGCAGCTATCGTCCATGCTCCCAAGGAAAACTCGATGATGAAGGCGTTTCGTACGGTGGTCTTAA
AAGCTTACAAAAATCTCGCAAACGTGCAGCGGTTTCAGCTTTTTGCGATGCGTACAGCCAGCCCTGGAATTGTGACGTGTCGTGTAGGACCGGATGATGT
GGGTGCTGATGAAGACCTACGAAGAACGTTTGATGGGATTAAGATCGATGATACGAAGGTGCGCAACCTTCTGGACAACTATCTTGAGCCCTTACAGCCT
CCAGCCCCCAATTTTGAAAAGAAGCAGCAAATGCACAACAAAGTGAAGCCGTACGTGCCCGTCGAGTATGCGTCGGACCCAACATACGCAGCTCCAACCG
ACGAAGAGGAACGACTCGCAAGCGAAGCTAAGCAGTCGCGTCGTAAAGCAAGCACGCAGAAGAAGAAGAAAAGCGCTAGTTGTCTGGAAGGACAACCAAC
GACGAACCCCGACAGCATGGATGTAACTACGGGCAGCACAGCCCAGCCTAAAACCTGCAAACCAACACGCAAGCGTGCCAGGAAAGAAACGTAGGCCCAC
AAAGGCACTAAATGTAAGCAGCAAATTGATATGATCCTTCTAGCCCGTACCCATTTGTTTTTAAAATAGGCTGTAAGTATCCAAAACAAATAAAATATCC
CCTCAAATTTGGGCCCCAACTGGTAAAGACATTCATTTGAAGCAGAAGGAAGTCGAATTAGGACGCGGGAATAGGCTCGAACGATGCGGATACGCTAACT
ACACAAGAAGAGTGAAAATTTTTTCCTTAAGTTTGTCTTTCTGGGAGGCAACGTTTTTGGTGGACTCGAGCTCCTTCACTTTTTAACTTTTTAGAAGTCT
GAAGGCATCATTTGAAAGAGGAGATCCTCCTCTTTCGAATGGTGTGCCTAAAACGCGATTCGTACTTAGGTTTGTAAGCGTCTTTTCGTTTCGCGCCGTC
TCATATATATATGAAGGTGCTGTG