Description :
From Genome Similarity Track
Location :
Scaffold_1339:624- 4131
Sequence
3507 bases(100 bases per row)
GCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGCGCGGGGACTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATC
GCCTTGACCTGCTCTCGCGGTAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAATCTCGTGCTGGATGCCCTTATCCTGCGGAA
GCTCCGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTTTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCG
CTCCTTCTTCGTCTTCGCCCTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTTTTCATTCTCGCTCTTCGTTCTCTCGGCG
TCCGAGAGAATGCATATTTGCTCGATGCGTCCGTCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACACCGACGCTTGCG
TCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGATACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCCGCCTCCGTCTG
CCCGGCAGACATTCCTTGTAGCGTCTCGGCCCAAGGCCGACACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGATCCGCTT
GATTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTTATACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGTTC
GCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATACAATGTCAAACTT
ATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTCGATCTTGATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCC
GTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAG
AATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAAGCTTGTCATCTTGGTTCTTGCAGTGAGGGTGAAC
CTCACTGGGAGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGATACGCGGAACTGCATTACCAGTAGGGCGCCCAGCGCCTACTGGCGTCCCGCGTTTT
TTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATATCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGATTCTACCGCATCG
GTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGT
GGCTGTTGCCTCGGCGCATGTGCATACAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAATAGTAATTGCAGCTTCGAGAGTACTCGGGTACT
CACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGAC
CAAGTACCGTGCTCCCTGAACGTAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGGTGGCTCA
AACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACACCCAACTTCTTGCACGTCCGCCAA
GACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGTTCACC
CTCTCTTCCGACATAGTTGCTCACATTGAGCTTCAGCGATTGCGCGCGTGGTGTCGTCCCGGACGACACCGCGGTAGTAGCAGCGACATCGCGTTGCTCA
GTCAGGATGAAACCCAGAGCAACACCGTATTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAGCGACAGCTGCCTCACCAATAGAGCACGTAAGAGCAC
TTTGCACCTCGCACTCTGTAGCCACTTTGCAGCCAAAAATTCTTACCTAAACGAATTTCGAACTTAGCGACCAACTTTGCAGTACAAACCCCACCGCATT
GTCGAATTTCTTGTAGCGGAAACCAGCTTTGCCTCCAACTTTGAAGGCAACTTTGCAGCGGGAGCGGCATGCACCCAAAGCTTTCACAACACAATCAGCA
GTGCAGCCCGCGCACTAAGCCAAGACAACTAAAGGCCGTCGACACGCAGACCAAGTGCAGAAAGAGCAACGCAGCCAAGGAGCCGCTCACAGCGCCAATC
GACGTGCCCATCAGAACCACTACGTCGTGTCGTGTTGGAGAGATCGCTTGAGCAAGCCCGCACGTGACAGCTACGTCTGCCCTTCACAACGGACACGATG
GCGGGAAAAAAGAAGCAGCGCTCGGTCAGCAAACGCAAGCGGGCGGCGGCGTGCGATGAGTCGCCGGGTCAAGGACACAAGGGGAAACCATCGCGCACCA
GAGCCAAGAAGCGAGCGCAAGCAACCAAGCAACGACAAGGTGCCTCAACCGCGAGCTGTCCCAAGTCGCGCCAACATGGATTCAAACAAGACGGGGATCC
TCTAGAG