Description :
From Genome Similarity Track
Location :
Scaffold_10:623988- 628900
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004557Similar to SLC38A1: Sodium-coupled neutral amino acid transporter 1 (Pongo abelii)
Pytul_DAOMBR144PYU1_G004556Similar to ALKBH2: Alpha-ketoglutarate-dependent dioxygenase alkB homolog 2 (Bos taurus)
Pytul_DAOMBR144PYU1_G004555Protein of unknown function

Sequence
4912 bases(100 bases per row)
TCTGCGCTCACTCATCGAGTAAACAGATGGTGGAGGTGGAGCCACAGCGTCACGTTGAACCTGCACCCATAAGTAGATCATGTTGAACCCACAGGTCGGT
GGAGGTCTCAGCGTGCATGAGGGTTCTCTTGTCACTGCCAGTAGCAGATACTGGATTCCAGTCAGCGGTCGCCGTCGCTTTGCGTCTCGTTTAGGTGGAC
GGAGCGCTCCGGACCGCACATGTAGAGCAATCGGTTGAGATCGCGCGACGCTTCGCGTGTATGCCTCGCGCGCTCTTTCGCGATGAGGGAGCGCTGAGAG
CGTGAGGCGAGGGGATCTGCAGTAGTGAGTTGGTAATTCCACAATTCTCGGTGTCCCGCGTACGTACTAGAGCTTCAGCTACGCAGTTCAGGATTCAATG
GGGAAGTCTGTGCGCAAGTACCGCAAGAATCGCGATTACGAGTACGTCGACCCCAGCACGGCGAGCGCGTACTACGACGATGACAAAGACTCGGAGCACG
CTGCCGGATCAGTCATCGACCACGACCTCCTCGCATCGCCACGGCACTTTATCCCGTTGGAGGAACTCGCCCAGGGTGAGAGCTCACCGCTCCAGGTCGT
GACGCTGCTCGTCGCAGCGTGCGTCGGGCCGACCGTGCTCGTGATGCCATTCGTGTTTCTTCAGGGTGGGTTCGTGATGACGATCTTCATGGTGCTCTTC
GTTGGAGTCGCGTCGTACTGGGCCAGTTCCGGTCTGATTCGCTTGGGCGTCGACCATGGGATCTACTCGTTCCAGGGCCTCGCGCAGCTCGCGTTTGGGT
TCCGCGGCGCGTTCGTTGTCGCTGCCGCGCAATTCCTTGTATCGCTGGGACTCATTCTCACGTACTTGACGATCATCTTCCAAGACTTCCCAGTGCTCCT
GGGACACTCGCTCCACTTGGATTTTGACGCAAACGGCTGGCCCATGGAGACCGACAACCGTCTCGCATCCAAGATTCTGTCCGATCGCACTCTATTCGCT
GAGCTCATTGTACGTTTCCGCTGTGGCCCTCGCTCTCACCGCCAACACAAGCTAACTAACTCTGCGTTTGCTTTTTTGTGATCTGACAATGATGCTTTCT
GTAGTCGTTCATCGTAGTGATCCCGATGTGCTTGTTTCTCTATTCCTACCGGAAGATGCAAAACTGGACCGCGGTGATGACGTTCCTGCTGATCATCGCG
TCGCTGTGTGCGGTCGGCAAAGCAAGATCCTACCATAACAGCAACACTCCGACAATGTCGCAGGGCTTTACAAGAGACTACGTGGCAGTGCCGTCCACGC
TGTGCCAGGCATTTGGGATCCTATCAACGCAATTCGCATGCCAGCACCACACGTTCCACACGTTCTACGCGTTGAGAAACCGATCGATCGCGCTGTTTTC
GCGCATCTCGCTGTTTGCGAGCCTACTGGTGCTCTACTTGGCATTCAGTTTTGGCATTGGCGGCTACGTGTCGTTCCTTGGTGCTACGAAACCTGATGTG
ACTCAAAACTATGACTTTGAAGCAAACCGGTCGATGCTGCCATTCTGGCTTTTCTTGCCTGTGTGCGCCATGATCTGCATCCCGATGGAGGTAAGAGCCA
CACTCATTTTCTTCTCTTGCTTGAGAAAAACAACTCATCCAGTTCTGTGTTTCTGCAGGTGATTTCGTCGCGATTCACTGTGTTGCAGCTCGCTCGCGCG
ACCGCAGACCACGATTTGGCCCCAGAAGAAGCACTTTTCCGCGCGCAACCGGAAGGAAAGCAATATGAGGCTACCAGTGGCTCCGATCCAAATACCTCGT
CGCTTGAGCACAAGACGGTGCAATGCGGTGAAGATGCCTCGTACACGCGCGTCCATGTCGTCATCACCTTTGTGCTGCTCGTGATCCTCGTTCAAATTGT
CGCCCTCAGATCTCCTCTCGATCTTGGCAACGTCCTGAGTGTCACTGGTGGACTCGCAGGGATCGTACTCATCTTTGTCTTTCCTGCTGCGTGCTACCTG
AAATTGCCAGTGAGCGACGACCGCCGAGTGGGCGAGATCACCGCTCGTCGAGTCTACACGAAATACGTCCCATGGGCCAGCATTATTGTCGGGATTGTAG
CTGCGATTGCGTGCATCATCGCCAACGTGGCGTAATCGTGGCTGCCTGGGGTTTCGACGCTCGTTTCTGTTCGTTTTGTTTGCTTCATTAGTTCGAATTC
TTCTTGCCACTACTCGTTTGACCAAATTCATATCTGCAACTCTGTTGATCGCACTTTGTTTGGCTCCCAAATACCTTCCTTTGACAACCATGGCGTGTGG
TTATATATGCTGCATTGGGACAGAAGTGCTCGTACACGCAGATGCTGAAAGAGCCCAGAGCGCTGTGTATTGAATGAAGTTGCAGCCGCATTTCAGTTTT
CCAAGTGCTATCTCGAGGCGCGCGCCAAAATGAGCTCCTCGGCCAATGCAGCGCACCAAAGTGTCCCCTTTCGCACATAAACGGGCCGGGTTTTTGCCAA
TGTGAACACATGAACCCAGAGCCTCCTATCTGCGACGTGTGCACATTGAGAGAGCTTCTATTCCTATTCCGGTGCCATTCTACAATCTACGAGTTCATGC
GCACATGGCAAACCAAAACGACAAGCGCGCGCTCGAGGACAAGATCGACGTGTCGTCGTCAGCCTGCTCGGAGTCCGTTGCGCCGAAGAAGCAGCGCGCG
AGCACCGCAGACCAGAAGCACAGCGTCATCCGCAGTAGTAGCTCTACCAGCCATCTATCACAAGCGTTTACGTGCGAAAACGTGGTTGCTCATGCAAGAC
AGGTGACGGCATCTATCTCCAAAGAAATCGACGTCGATAAAGTGTTTGCGGACGCGAAAGTTCACTATCTCACGCGTGACCGCGCGAGTTGGGTGTATCA
CGTGCCTCGCTGGTATCACCGCATGTACGCCTTCTGTGATGGCAACCGCCATGGTTCATACAGGGAGTGGCTGGATCGCATCTGGACGTTGCATCCAGTA
GATCATGGCACGATCAAGATGTTTGGCCGCGACGTCCTCACGCCACGTTTTCAGCAAGCGTACGGAGTGAGCTATCGATTCTCAGGCAACACGTTTGAAG
CAGTTCCTGTTCCAGAATCACTCCAGCACTGCGTGGAGTTGATGCAAGCGATGGTCGTGAACCCAGCCACCGACAACACGCTTCTCAACGGCGTTCTGTT
GAATTGGTACGCGGACGGAGATCACTATATTGGCCCTCACTCTGACAGTGTGGGGGCCTTGTACAAGCATTCACCAGTGTTTTCGCTCTCGCTCGGCGCG
ACGCGAAGATTTGTGTTTACGGCCAAGACAGGCAAGTCGAGCACAGCCAATGACAGAAACGGAGCCGTTCAGCGACTGGAACTTGCTCTCCAGAGCGGCG
ATTTGATAGTTATGGGCGGCATGACGCAGCAAACGCACAAGCACGCGCTGCCAAAGATGAAGAATTGCATCGAGAAACGCGTGAGTATCACACTGCGGTG
CTTCGTCACGCCATCCTAGTGGGAAAAAAGGCGAACGTTCGCCATAGTACGCTGCTTTATCATGAACCACTATTTCAATGCAGAGAAGTATCTGCGAGCT
TGGTCTGCGTTTAGCAATTACAGAGGAAGGAAAGATTTGATTAAGATGTGGATAATGATGTGCCAGCATGCAGTAGTTTGAGTTCTCGTGTCGGAAACAA
CTGAACGCAACGAAAGAACTCGTAAAAGCGGTGTATCGTTGATAGCTACGATTTCACTTGGACCTTCTTCAGCATCTCATCCCCTTCAAGATGACCATTT
TGTGCGGCCACTGATAACGCGGTTACTCCATTCTCACCGACCACATCTACACTTGCACTCTTCTCCCATAAGATGGAAAGAACGTCAACGTGACCTCTTA
CGCAAAAGGAAGGAAAGCATTTTTGACGTCTCCATTCGCAGCAGCAAGCCACAGTACATCCGACGCCTTGCCACGGTCACTTTTCACACACTTGTTTCTC
CAGCAGTGCGGCGAACCACATTGAAGTGGCCTTTCTTGACAGCCCACTCCAATGGAATCCACCCATTGAGATTCCTCGCGTATCATTTTCACCGTACTCC
AGGAGCCAAGTGACCACTTCAACACAGCCACTATCAGCAGCAACCACCAAAGGACTTCATCCATCTTTGCCATCGGCCAATTTTGCGCTCGCACCCTTCT
CTGGAAACACAGCCACCACTTCGGTGGTACGCCTGTTCCCTGTTGTTGTGACCATACTCGAAGCGATGATCAATGGAGTCCATCCAGCCTCAGTTAACGT
GCTGATGCTCGAACTCTGCTATGACAGCATGGCAACCACGTCGGCGTGACCATTTAAAGGAACTCAAAATAACGGATCCTATCCTTTGTTACCAGCCATA
TCCACGATCGCTGCATTTTGTAAGATCAGCGAAACAGCTGGGATATGACCATTCAAAGAAGCAAGGAGAGTGGTGTTGAGCCATCGTTTCCAACCATGTT
CACACTCGCACCCTTCTCCACTAGCCTGATAACGACACCAATGTGTCCATTTGCAGATGGAGCAATATGGCGGTTGACGCGTCGTTGGAGGTCATGTTCA
CGCGGCACTCTTCTCAAGCAGCAGTGAAACAATTTCAACGTGATTCATCGTCGAGCGTGGGTGTGTCTGCGCTCGCATCCTTCTCCAGGAGCAGGTTTTT
GTTAGAACCGACACGTTCCGCAAAGTTCGCGCTTTCTATGCGACATGAGAAAACTTGCCTTTTGTATTACCTACAGTATCACTTATGAGAGGGCGTTATC
GTCTCGTTTTCAACCCAGACCCAGAAGAGCAAATTGAATATGTCGCGTAGAAAGCGGCAGCTCCTCCTCTCCGAGGACACCGCCACGCCGCGGAAAGCTC
AAAAGGCGCGAG