Description :
From Genome Similarity Track
Location :
scaffold_4:62396- 63945
Sequence
1549 bases(100 bases per row)
GACTCTTTGCATCGAATATTTCATATATTTCAATTATATTTTAGTGCACGGTAACTCCTTTGTGCTTGATCGTACTTATAGTCGATCCCACGACCGATTC
GTGAATGGAAGATATTATATGCAACGTCGACGAAAGCGACATTCAAATATTCATTTCTTGGACACTTACACAGCTTGATAAGCTAACGTCCATGGTTGGT
CCCGACGAGATAAGAAAACTAGCAGTCAAAGGGCCAGATACAGTAAACGCTTACTCAGAGACGCTCACCAGCTTTCAAATTCAAGACACCTCAAACTGGG
CGATGGTAAATGAATGAAGACCACCTTCATTAGGCCGCTACTGCTGAGGTGTCAGCCCTTTAGGGACTGGGATGGGAAAAATCTCCCTCTGGAGGAACAA
AGTTGAGGTAGTCATGACTTCAAGCAAAGCAGCACCCGTAGCGATTGCATTCAGCGAGCAAGGAGGCTGTACACGGGGATGGACACAAAAGAGTTTCACT
TCTGTCGTGGAGACAGTCTCAACATGGGAATATTAATGCCGTAGGTGCTCACATCGTCTACTTAGGCTTATCGGGTGCGCTCAAAGCTGTGCTCACCCGT
CAAGGGCTAGTTAGCAATGTCCAGGAGCTAAGAATATAATTGCCGAAATAGTGTCGGACCCACTTTTGGAGGCAGTAATAGTCATCAAATTCACAGAGGG
TCTCCGAATGGGTATGACCAGCACCAAAACCTTCTGTATTCTCGCAACCTCTTCCGAGGGAGCTGTGGGTGTCAATTGGTTACAGAGTACTATTTTCGTG
CGCATGATGCGGACAAAAGAGAGAATAGCTATATATGCATATGTTTTAGCCATGGGAGCGTAGGATTTAGCGCCTTGCAACCCCCTCTCTCTCAGCTACG
AGGTCGAAGGGTGGGTCTCCTCCGTAAGGCCGCTTGACAAACACATCACAAAGAAATGTCGAATTTTAGAAGGCTCAGGGCGACCTCTTGAAAATACACT
GGGATTTAAAGTACCTCGTGGAGGTCATGGTCAATACGGCTCAATATCATAAAAGCGACTCTTTTAAAATGATAGAGCCTCTGGATCTCACAGCCCACAT
CTGTTGATATTAGCAACAGCGTCCAGAAATTTGTATAGCCATGTAAGCAAATATATTTTCAGGAGCGTCGAACAATTACGTACGACTCGCGTGTGTCGAA
AACAGTGGACAGTTTGAGAAAGGATACGACATTCGTGGGTCTTGCGACGAAAACGCCAGTAAAAGTGTTAAACGTTATGTTAAATCTTCAAGCAGAATTT
AGGGACTTCATCGACGTGATACGCTGTCTAGACCTAAACCTGAGTTCGCGATATGATCTCGTCCGAGGTTCGACGGGGCTGGGACGCCACAAACCATCGA
TTTACTGGAGAGCAAAGAGATAAGGTGCTACGCACTTATCTCCTGGTGAAGCCTTGACGATTAATGAAACCACCTCTGCCGGGAAACCGAAGCGACTTCG
GTGCGCCACGAAGTTGCGATAGCCTCCGCGCAAGACATGGGACTGTCCG