Description :
From Genome Similarity Track
Location :
Scaffold_51:623812- 627395
Sequence
3583 bases(100 bases per row)
CATATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTC
ACACGAAGATCACGCTGGTCCAGGATGTAAGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGTGAGTACTTGAGAGTTTCCACCCATGCCC
AGAACATGTCCTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGATACCACCCCGAGACCCGTGGTCTCG
GGCTTCTTACGACAAGTCGTGAAGTCCTTAACGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTT
TCTGAACAAGGGCTCGTTCATAGACGCCCCTCGAAGTGTGGCCGCCCACAAGGCCAAGAGGAGCGACGAGGACCTCTAAGAAGAGGTCAGCCCCAGAGCT
CTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGATGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAAT
CCTCGTGCTGCTGGGCGAGGTCATTCGAGACCTCCTGGGGCTCAACGATAGCACCCTCCTCCTCTTCTTTCTCCTTCTCCTCCTCTTCATCTAAATTGTG
CTAATTCTAATTTCATAGTACCTGCTATTTGTTTCATAGCTTTAATTTGAGCTGCAGAACCTACACAACTTACAGATAAACCAACACTAATTGCAGGTCT
TTGCACCCTCCTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTTCTCGAGGAGTGG
AGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCCTTTGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGA
TTCTCTTCCTCATCGCCATCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCCGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCAC
TAGCGGGCGACTGCACGCTGTCATCTTTGTGCTTACTGGGCACTGGGCTGTGCCCTCCCTCAGAGCCCGCAGGAGCACCATGAGTGCTCTCGGACTCGGC
ATCGTCTTCACTGCCCGAGTTGAACTCACGTTCCACGAACCGAGGGCTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGC
TTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTTC
TTTGCGCCTTACCGGCACCAGCCTTGGAGCGTGTCTTAGAACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAG
CGCACAGGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTTCGCCGCGCTAAGTCGATGGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACAC
CTCTTCATTCTGATTGGTCGGTAAACCGGAACCTAAGTGGGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC