Description :
From Genome Similarity Track
Location :
Scaffold_642:6236- 7405
Sequence
1169 bases(100 bases per row)
TTTCTAGATCTAGTTAAGAATGCAACGATCTTAACCGAAAAGAAGGTGTTGATCCGGATGGAGCAATCTAGAACGGGTTAAGGCCGTTAGAGTTGATTCA
GAGGGAATAATATGAGACATGTCAAAACAGTTATGGGCTCAAGGTCGATATGGAAAATGGATGTGTACCAGGTCCGCGGGATGTCGATTTTAGTATCGGG
TCGACATGATTCCCCGCGACGATAAATAAAGTATTCGATGAGACGGCCGAACGTGATGAATATACTCCGTTGGTTGTATGAAAGGATGCAATGAAAGATT
TAGGATCAAAAAGAGTCAGGGGGTAGCGTCCAAGGCAACATGGCAAAGTGTATTCTCGATAGTTGGATATATTCTCGACATTTAGATATGTCACCCAATA
TTTGATTATATTCTCGACATTTGGTTATATAAGCCGATAGTTGGATATATTCTTGATTTTGGAAAATAGTGGCAATATGGCAAAAAGGTGTCATTATTGG
AGTATAGACCTTGAATTTTCGACACGTGTTTTATAGAGCAATCTGGTAGAAGTGATATCAGCTCAAAAAGTATTCTGCAGGGTAGAGTAGGCATAGTGAA
AGTTTTTCGCTATTAATTGGTTGGTAATAAACAGGCTTGAATTCTACTCTATCTACACGAAACGCGACCCGCTTATCCGGGGAATAACATCTTTGGATTC
CCGACGACCGAAGGCGCACGTCGCCTAAGGCACAGAAAACCGATCTTGGATCTTTTGGCCTAGATCGCGAAGACCGATCCTGTATTTTTTGGCCCGGATC
GCGGAAGTTCTCAAGACAGGACCACTGCTATCGGACGCACCAAACATGGAAAAGGACTGGTGACCAAAACGGATGAGGCGATCTGGCACATTCCGATCTT
GCGATCTTAAGGTGCGATCAAGCTTACAAGGAAGCAAGCACTGAGACCAAGTGGAATCAATCGTTTGCGAAAAGAGCCAAGCGAATTCAAGGCATATTGA
ATCGATTTCAAGTGAGATGACACAAGAATACCCTGATTACTCCGTCAAGATTTCCACACCGTGATCACCCTCATCCAAAACTTCAAGCAAGATTGACATC
TCCCAAGACCATTTCGAAGATCTCAAGCCAGCCCAACCGACGGGTACAAAATGTGAGCACAAGGCTATA