Description :
From Genome Similarity Track
Location :
Scaffold_1011:6233- 8568
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1011-snap-gene-0.6Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_1011-fgenesh-gene-0.440S ribosomal protein S18

Sequence
2335 bases(100 bases per row)
CCTCGCCGAAGATGCCACGGATGCCGGCGCCGTTGAGACTGCGTACCGCTGCGACGCTGCGCTCGACTGTATGGACGCCAACCTCNNNNNNNNNNNNNNN
NNNNNNNNNNGCCATGTCTGCCGCGACCACGTATGCGTGCCCGACAAGCTCTTCCCGCTCTCCCGCACCGAGATCTACGGCTCGATCGCAGCGTTCATCT
CCAACATTCTCGCGGCCGGGTCGGGTCTTGGTGGCGGCGGCCTGCTCGTGCCTGCATACATTCTCACGATGGGACTGTCGTCCCACGAGGCCATCCCGCT
GTCCAAGGCCACGATCTTTGGCAGCTCGATCGCGAGCTTCCTCATCAACGTGCGCAAGCGCCACCCGCTCGCGCGTGACCGCCCCTTGATTGATTACGAA
ACCGTGCTGCTGCTCGAGCCCATGACGCTCGCAGGCACGATCATTGGCGTCAACATGAACAAGGTGTTTCCCGAGTGGCTCATCACTGTGTGCATCGTGT
GGCTGCTCACCAAGACGAGTCTGCGCACGTATGCCAAGGGAATTTCCATCTGGAAGCAAGAACGCGCGGCCGACAACAAGATGCTCGCGGATATCGTCAA
CTACTGGAAGCTGCTGCCCAGCCAGAGCAACTTCAAGCAGTTCCAGGCCGTGGCGCGTGCCTACCTCAAGTGGAAAGCGTACAAGCGACCGACGACTTCC
CTCACCTCTTCTGCCAAAGTCTTGGGCAAGACCCTGGAGATGCCGAACCCACAGGAAGACGACCGGTCGTCGCTCGCGAGCACTGTGCTCTCCATCAATG
ACCTCGACGATGACTTGGGCCTGAGTGACAATGCCAGCGAAGAAGAGACGCTCATGAACGCCGGCGTCCAGAAGAGCCACTTGCTCATTGACCACATGCC
CACTCTGGACGAGCTCAAGGCCTACAGAAGTCGCGTCCCGTACGGTGATCTCGTCGTGCTCTTCATGACGTGGATTGGATTGGTTCTCTTCTCGCTTGCC
AAGGGCGGCCACGGAAGCCCCAGCATCATTGGGCTCGCGTGTGGCAGCTTGGGCTACTGGCTGCTCGTGGCTCTGTCGTTCCCATTTTTCGCGTTCGCGA
CTCTTTACTACGGCATCAAGATCGCGCGTGCCCACCGGTTCCTCCAGGCGTCTGGGTACGAGTACCTCAAGGGTGACATGGTCTGGGATCGTGCGGCCGT
GATCAGGTACCCGGCGCTATGCACGGCTGCTGGTTTGGCGGCTGGACTGCTGGGCATTGGCGGCGGGATGGTGAAGGGCCCACTGCTGCTGGAGATGGGC
TTGCTGCCACAGGTCGCGTCGGCGACCTCATCGTCGATGATCCTCTTTACGTCGTCGGCGACGACCATCCAATTTATTGTGTTGGGCACGCTGTCTGTCG
ATCACGCGTTGTGGCACGGCTTCATTGGCTTTGTCGCGGGCGTCATCGGCCAGTATGGGGTGTCATACCTCATCAAGAAGTACCGCACGGCCGCGTTTGT
GATCTTCCTCATCGCTGGCGTTGTCGGCTTTAGCGGCATGATCATGGGCGTGCTCGGCGCGCAGAAGATCGCGGTGACGGGTTTTGGCGGCTTCCGCTCG
CTGTGTCACGCGCCACATGCGTAGAAAGACGTCGGAACCCCTTTATTCGTAAATTATCTAATCCAACTACGAATGCCTAGCTAAAAGCTGGATTTTGAAG
ATGGATGCTGGATAAATAATCCTTTATTGACCATGGCCGTGAAGATCGGGTGACGCGTTGAGGATATGCAAAGGCGCCTTGATAGACTACAGTAGTGGTG
GGGCGGCTGGGGTGTCGTTCAGTGGGCCTAATCCACGCCAACTCGCACCGTCGCGGGTCGCCTTGTGACGTCGATGTATCCCAAGGCATTTGCACCCCAA
CAAACGGCATTAACAGGAGACAACAGTTCGTTTTGGAAAGCAAAAGCAAACCCACTGGCCTTTCAGTTTTTATTCGCTTCACCCTCTTGTGTCATTGTTA
CCACGCGCTCCAGTCGCTGCAACGCCACGCCGCCACGGCATGAGCAGAGCGGCGAGCCAGCAGTGTCCGAAGCGTGCGCACCACCGACTGGCATCGCACC
AGGAAATCAGCACCTCTTATTATTGAACACAGCTGACTAGTAGCCTCCTCCAGAAGAGTCGAAGGTTTACTTCTTGCCACCCGTGATCGCAGCGAGCATG
CCCACGACCTGGCGACGACGGCCCGTGGTCTTGGTGTGCTGGCCACGCACCTTGAGGCCCCACCAGTGACGGAGACCACGGTGGACGGCGATCTTCTTGA
GGCGCTCCAAGTCGTCACGGAGCTTGCTCTGCAGG