Description :
From Genome Similarity Track
Location :
Scaffold_41:62319- 76117
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14704hypothetical protein
Phypa_INRA-310PPTG_14705hypothetical protein

Sequence
13798 bases(100 bases per row)
CGTCGAGGCCGCATTGTAGGTCACCCTACTACACGCCATCCCCGGCTCCAAGATCGCCCTCGATCTTGCCGGCGTCGTCCAACTCCTCGAACTCCACGTG
CGTGAGCCACCACCGCCCACTCGGCTGCCCACGTTGCGTGCTGTACTCGACCTGGTGCTCGAGCGTGTAGCGCCCCGCCCGATTCCGTACTCTTCGTCTT
ACTCTCTCAACAATGTAACCAGCCGTCGCCACTTGCAAGAGTGCGGGCATCGGCTCCGATCGCCTCGGCCTGCCCCTGCCTCGTAGCATCTCAACCTCTG
CGGCCGCACCGCCCGTGCGAGCTCCTTCGTCCGCCTCGCCTTCCATACTGGCGTTCCCGTCGTCTTCCCGTTGCTTGCCATCCCGTTGCTCACGCCTGCC
AGGCCTGCTCTCCGTCGCCTTGCGTGGTCTCTCGTCCTCGTGGTGTCTCAGCACTAGCGTCCTCTCCGTGTACGACGGCAGCACCACCGCCGTTTACCCG
ACTACCACCGTCTGCACCCAACGCCGCTTCGGCTGTGGCCGTCTGCTCGTCATGCAGAGCCGGCCGCTTCGTCGGTCGTCTGTCCTGCTCGTTGCCGTCG
TCATACCTTAGCCGTTGCTCTTGTCCGTCCCGGCCGCCAGCGGGTGTACCTGGTTCCACTCGTCGCTTGCGCTTCTCTTTGCACACTGACCGTCGCGGCA
CCACCGCAGCATCACCAACCGACGAGCTCCCAGCGTGCCCGCCTACTCCCGGTCCGCGCGTTCCCGTTTCTCCTGCGCGCACCGAAGTACAGTGCTCCGC
TCTGTCGCCCTGCGCACCTACCCACCTGGACGTTGCTCTCCGTCTCGCCGTTCGCCACCCCCGTCTTCTCTGCCGGTCGCGGCCGCCACTGCCAACGGCT
CCTGCTGCATTGTCGTACCACCGTCTCGTTCCTCCGTTTCGTCCTCCTTCGCGGCTAGCTCTGCCAGGATGCGGTCCGCCACCACACCCAGCGAGTTACT
CGAGCATCTGCTCGACACTAGGAAGCTACAGGGAACAACCATTCTCTCGCCGTTGTCTTCACGGACAACTTCCCAATTGTCAAATCCCGCACTTTGTACA
ATCTTGGCCGGTCCGACCCACCGGTGTGCCAACTTTGTAACGCCCTGACCTCGTGGCGGTCTCAGCACCCACACTAAGTCTCTTACTTTGAACGTCGTTG
CCTGACGGACGCGTTTGTTGTAGTAGCGCTCCCGGCGTACCTGGTCTCTTGCGATCGCCGCGCGAGCCGCTCTCGTCGCCTTCTCCATGTTGCTCACCAA
TCGCCTGTGGTACCCGGCGAAGGGCTGACTCCGCTCGTCTTCAGTAGCTCGTTCGGCGTCTTCAGTCGACGTCCAATCATCAACTCATTGGGGCTGTACC
CCGTACCGGAGTGCCGTGCTCCATGGTACGCGCATGCTGCACAGGGCAGCCTCCGGTCCCAGTCGTCTTGCCCTTCGGTCGTGTAGATCGACACCATATC
TTTCCATGTCCTATGGAAACGCTCCACCAGCCCGTTCAAGGCCGGTCGATACGGTTAAGGCGTGAGCTGTCGTGCCTGCAGCGTTCTCACTAGCTCTTCC
ACTATCTTCCCGTTCAACTCGGGCGCTCCGTCCATCACGATCTCGCGCATCGGCTCGTGCGCAAACACCAGCCTCTCCACGACGAACCCGGCCACGTCCT
GGGCCGTGTGGTGCGGCATCGCCGCGACCACGGCGTACCTAGTCGCGTAGTCCACCGCTGCTATCACGTACCAGTTGCCGTTCTGGGTGACTGGCAAAGG
CCCCGCCACATCCAGTGCCCACCGGTCGCCAGGGCTACCAACCCCTTGGCTCCTTAGTGGAGGCACAACCTTCTTCGCTTTCCTTGATCTACAGTCCCGA
CAGGACTGCACTCGGGCTACTCATGGACGGATTACCGTCCATGGGTTGGTTTTCCGCCCCGTGTTCGTATTTCATACGAACTCGTAGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTTCTGGTGTGCCTCCAATCGCAGCGCTCA
AGCGTTGACGTCTCGCCGAACTTCTCCATTGCCAGCCAAACAGCTTTCCACGCAATTTAAAGCCATTTCACCCGATTTTATAAGGCCTTGTGCCCGTTGC
TGGACTTGTCAACGTGGAGCACGCAGTAGATGAATGAGGGTCTGTAACGTGCTCCTGCCAAGTAGAGCGGTTGAGGTTACGAGTGATGTGATTTGCCCTG
AGGCGCCATCCGATTGTCGATGTATCAAAGGTAGAGCGCCAGTGCTCTTCTAACTTCTCTGCAACTTCGCGATGGGAACATTCTGCTGTAGCTCCAGCAC
GATCCGTATGCTCAGGTCTGATGCAGGTAACCAAAAATTGCTCCAGGTCTTTAGCTTTTGATATCGCCAGTCCATATTCGAAGATGAGAAGTTTAACGGT
CTTCCCACGTGACGAAACCAGCCACTGATTCCATGCCTGTTTGGACTTGGTGTTGTCCACAAGGTGATTGTTGAGCTTACCTGCATCACTTTTGTCCATG
CCAATTGTGTAGGGTGTTCTTGCGACCAACTTTCTCCTAGCTTAATGGCTCGGCCTTTCACGTGCTGGATAAATGCATCCCAGATCTTTTGAATGATTTC
CCCGAACGTGTCTCCATTAGCAACGAAATCATCAAGTGTGTTGCCAGAGGAATCACGCTGACCAACCGTATTCTTGATAATAGGTCGGACTACAAGCTGA
AACCGTTTCTCCTACGCACAACTTCTTTGGACGGTGTGGTACAGCAGGTTCGGCTTGCACTGCGGTCAAGGCCGTTGCTGCCGTTGCACTCACTTGCTGT
TGGACCGGGGATGTGGGCCTGTCCACTGCTGTTAGCGATACGTAAGGTGCTAAAAGCTCGGGCTGCTCCATAATAACCCTTGCTCTGCTTTCACGTTCGG
GTGCTGGAGACGAAGTAAGACCGGAACCCGATGATACGTGAGAGGATCGTTGCGATTGTAATCTCTCGGGTGTGGCACTTTCTTCTTCAGCACCCACGGC
AATGTGTCGTCTCTCTGAGTATGGTGAAGCCCGCATTCGTGCTCTTGAAGACCTTTGTATAGCCGTCGCAGCGATCTGAGTAGCAGTTCGCGCGCTGTTC
ATGTTGCCTCTGTAAGATTGAAGCCATCGTGTGAAGCCAACACCTGTGTTATGCAATATCACATACGTGCGGCCCTGCCTACTTGCATTTGAAATAAGAG
AGGATGAGCTATTGATGGCTGGATTTCGTGTGGGCGGTTAACCAACCCCTCAATCCAATTTCGAGTAGAACTCACGGGGCACCTACAGATAGGACTTCTA
CCAACACAAACGAAAATATCACCAATATGGATCTGAGATGTTATGTAGAGAACTAGATACAGGGAAGATTAAAGACTCCACTGCAATAAGGAATAATCAC
TGTTCGTGGACTCTCCACGGTGGTAGCCGTTGATATCGCACTACCGACCAATACATCACTCGGGTGTACGACGTCAGCCAGTACATTAAACTGCGTCGAT
GGTCGATGTACGAAACCACGATATGCAGTGACGTTCCAGAAGATGGATGCATGGAATGCGGAGAAATAATGAGGGGGGGTCCCGACAGGACTGCACTCGG
GCTACTCATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNATATTTTGTGTGACATGGAACCAGCACATGAGTACAGTGCTATCAGGTATCTCGTTTGTGCACGCGTTGTACTGAGCTTT
GTCAGCATCCATCATTACAAAGTCAGACAAAAATTGCACGTCGAATAATTCCAGAATCACACGCTTTAAAAACGCCAAATACCATGCAACATCTTCATGG
CGCCGTTGTGATGTACAACAGTATAGAATAGGCAAGAAGCTTCCAGCACGATCTGAAATTTCGGCAACAGAAACAGGATATTTTTTTTGCTTCACGCAGT
CGTATGTAGTGTCTAGATGTATAATAGTAGAAAGTGATGGGTTTTGCTGTACATCGACATAGCGCTCCAATAGTCTTGCGCATGATAATCCAATACGAAA
CGGATTGCCTAACGCACCCGTACCAAGGGCTGGCTCAACTACACCACCCACCATTTAGTATCACAAAAACCTAGCAGAGAATCTGGATCTTGATCCCAAA
CTCTACGCGAATCTTCACAATCGTACATGCATAAATCGTTAGAACCGGATCCATGGAGTCGGGTCGATTCTTGCGCCGCCAGCCTTTTGGTAGTTCTGTA
CCTGAGCGAGCTCGGGAGATGGACCACCAATTCGCCCGTCTCTTATCTCACGACATAGAAACGAGTACAAAACTTGGGCAACCATTGAAGGGGTATCTTC
AAGTTTAGAGTCCAGGTAGACTTTCATTTCACCAGTTAGCCTAGCTGTTGTAGTAATTGGTGGCGCATCGTCAGCCATAGTATCTTTACCTTGCACAAAC
ACAATCTTGCCATCACTTTCCTGGCATTCTAATATTTTGTATCGGCAGTGACAGGTTTCCCCAGCGGCCTTGCATCGCTTTGATTTGCACTTGGTGACTA
TGCACCGCATCTCGTGCCACGTAGATGTCAGATTGTCCTCGTAGTGGGCAATGTGGTATACTCGACAATGATGTAGCTCACTAGTCGGACGGGAAAACGG
TGGTAAGACAGCTAAGAAATCGTCATACGAAATAGTGCCTCCAGAACTCCACACTTTATGCCATGGAAGGCGTCCAGCGCGCCCGCTCTGTTCAACCTCC
ATGCATGTGCTGAAAACGAAGGCTTAAGTAGTTACTTTCTACTACTGTAGTGCTGCAACTGCTACGCTCTTTTAAGGTTGTGGTGAAGCCATATCTATTT
GTGGTTATGCCAGTGTATTTTGTGAAACCTCTCTTATTTTTGAGAGTGGATCCTGTCCCCGACTGGCAGGTCTTGGTTTTAGCATTCCCTGAATTTTGCA
CAAAACTAAATTTCGCAAACGATCCATGTATACATACACGCTCTGTATACATTTTTATTTTAAAATATTAACGACTGGCTGTCATTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN