Description :
From Genome Similarity Track
Location :
scaffold_81:62297- 64166
Transcript NameFunction/comments
g3007.t1 hypothetical protein PHYSODRAFT_353776
g3008.t1 enoyl-CoA hydratase/isomerase family, putative

Sequence
1869 bases(100 bases per row)
AACGGTAGCGGCGCAGCGACAGAGTGTTGCGACGCTTCCAGTTCTGACGGAACGACGAACCGATGATCTTGTTGGCGCGGTGGCCACGCTTGCGCAGGCC
ACGGCCCTGGCGGCCGGCAGACGTGAGGCCACGCTGCTGGCGGCCCTTGTGCACGGCGTTGGCGATCCAGTTGATGCGGGGGTCGCGACGGATAACCTTG
TGCGAGTGGTCCACCATGATGATCTCGAAGTACTTGTACGTAGCGTCCTGGTTCACCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGG
CACGCTCCTCAGCCACCGAACGAAGGTTACGCTCGAACTTGAGCTCGTTGATACCGTGGTGCTTGGGCTTACCGTACACAATACCCTTCGAGTTCGGGCG
CTTGCGGCCACCGCGACGCACGGCAACACGCACAATAACGAAGCCCTGCTTGGCCTTGTAGCCGAGACGGCGAGCCTTGTCCACACGGGTGGGGCCCGTC
ACGCGGTGGATGACCGGCAGCTGACGGTACTCCCAGGCGCGCACACGCAGCAGGAAGCGCAGCACGTCCGACTGTTTGCGCTTCCACAGCTCCTCCAGGT
ACTTGTAGGCTCCCATTCTTCTGCGACTTTGCTAAAATGAAATGCCCGTATACAAATTGACGGTCAGGCAACGAACGCGCAGCCTCCAGTCATTTAAAGG
ACCTATCGAGTCCAGTACCGTGAGTACATCGAGACACAATAGCAAAAGATAATAGAATTACCATGAAATACTTCTAAAGTACGGTTTTGGGTGCACCACT
TCACACAATCACCTGCTTGAAGTTGGCGAGGAGATCTGCGGCCGACCACTTTCTCTCTTGACGCTCGGTGAAGATGTTGACGAAAGCAATGCGCGTTGCG
CCTCGGTTGCAGACGGCTCGTTGGCTGAGCACGACCGCGAAGGCGACGCAGTTCAAGGTGGAGATGCTGGGCGGAAAGGACGCGGGCATCGCGCTCTTTA
CGATGGACCGCCCGGAGGCGCGCAATGCGTTGGGTCGCCAGTTCATGGCCGAGTTCCGCCAGGCGCTGGATCAGGTCCGTTTTGACCCTAAGGTTCGTGT
GGTGATTCTGCGCAGCCTTGTGCCGAAAGTGTTTTGCGCGGGTGCAGACTTGAAGGAGCGACTTGGCATGAGCCAGCCAGAGGTAGGAAAAATAAAAGCT
GTGGTAAAAGAATTTAAGAAATTGATGGCGTATCTGATGTATGTAGGCAGCAGCTTCTTCACGCGGCTACCGCACAGGGTTCACCGAGCTGGAACAGCTT
CCCATGCCGACCATTGCTGCAATTGAGGGTGCTGCACTTGGCGGCGGTATGGAGATGGCACTGGCTTGTGATCTACGCATCGCTGGGGCCAAAGCGATCC
TCGGCTTTCCGGAGACATCTCTGGCCATCCTACCAGGAGCTGGAGGCACCCAACGCGCATCCCGTCTCATTGGTGAGCTATTTACAGTCGGAGATATCAA
TGTGAAGAGTTATGCTCATCTTTTGCTGTTGCGACTGCCGCACAGGCATTTCAAAGGCCAAGGAGCTCATCTTCACCAGCCGCCGCCTCAACTCGGAAGC
TGCTGAGAAGGTTGGTCTTGTCGACTACGCTGTTCCTGAAGGCAATGCCTACGACAAGGCTCTGGAGATCGCGCGCGAGATCCTGCCCAACGGCCCTGTC
GGTGTGCGCATGGCCAAGGAGGCGATCATGAGGGGATCCGAGGTAGACATCGCCTCCGGAATGGCGATTGAGAACGCCTGCTATGCGCAGGTAGTCCCAA
CGAAGGACCGCATTGAGGGTCTTGTGGCCTTTAAGGAGAAACGCAAGCCGCAGTACATGGGCGAGTGAA