Description :
From Genome Similarity Track
Location :
scaffold_1045:6225- 7782
Sequence
1557 bases(100 bases per row)
GGGGTCGAAGCCCCCGCACTCGACACCAACCATGCGTGCCACCTACTCGCCGCACCTCTCACAGCAGATGGCGAGGTGGCTGTCATTCTTCGTAGAGTAC
CATGTCCGCCTCGAATGCAAGCCAGGAAAGCTCAATGTGCTTGCCGACACATTGCCACGTCGAACTCATTATGAACCCGACTACGAGTCGGCACACATAC
GCCGGGTCACGACAGATCTACTATCGGATATGCTTGGTTCATCGGGAGGATGAGAACTTCGCACCTCTGATTCTTACCCGAAGGCAAGGATGCCAAGGTC
GGTCGGCTATCGCCTCGACAGCGGTCACAGCTTCATCAGTATGACCGACGGCTAACTCCACTATTGACTAGAACGAGGAGATCCCCCTCGTGTCGTCGTT
CTGAACGACGAGGATCTGAAGTATGATATACTTCTGGAAGCGTGTGACGCACCGTCTAGTGGTCATTTGGGCAGAGAGAAGATCTACCAGTCGGTCTCCC
AGACGTTCTGGTGGTCCCGCATGTACAAGTGGGTTGTACAGTACACCAAGACATGCGAGACATGTCAGCGGGTGAAGTCAGCGGGGAACGCCTCTGCTCC
TAGAGCCTTCCTGTCCCAGCAGATTGTTGGAAGTCGATGAGTCTCGACTTTGCCTTTGACCTCCCGGTCTATGGCAAGGGCAATGCCGGCGTTTTGGTGT
TTGAGTGCCGTTTGAACAAAATGGGACATTTCGCTATGGTACGTGACAAGATCGCAGGGAAGCAAGCTCCACATCTGTTCCTCGATAGCGTGTTCCGCCA
TCATGGTCTTCCGGAGATCATTGTCTCTGATGAAGACCCGCGGTTCAAAGGGATTTTTTGGAATACTCTGTTTCAGCTCCTTGAAACGAAGTTGGCAATG
TCAACTGCGGACCACCCTCAGACGGATGGTCAGATGGAGAGCGTAAATTGCGTAATCGAAGACACTCTACGCAGCCTCTGTGCTGAGGCATCTCGGCCTT
GGTCGGACTAGCTGCCTACGGTCGAGTTTGCACTCAACAATGGTACACGCATCAACGGGGTTCACCCCATTTTTCTTGAATGGACTGCGACACCCTCGAG
TACCGTTAACCTTGCGGAGAGGCTCTAAAAGCCTGGGTTTCCGAAGTGAAACTAGAGTCGTTGAAACGACAGTTGTCAACATTTGTCGACGATAGGCTGA
CGCTTATCAACCGGGTTAGAGACGTAATGGCGTTAGCCCAATACAATCAAAGGAATACTCGGACAAACAAGATCGACGAAACTTAAACGAGTTTAACAGT
TGATGATCTAGTGCAACTGGACACAAAAACCTACTGCTAAACTTGGTTAGCTCCGTAGGAAGCAACAAGTTAGATGCACCACTTCATCAGACCCTTTGTA
GCCCTCGGTAGCCCTACACGATATATTTGCCAAATTCTATGCTGACCCACCGAACGATTTACATAGCCGGTCAAAAGTAGTATCGTGACCTACTGGTCGG
TTATTCTCAAAAGGGAGTGTGCGACCGAGAGAAGTCGGCTCACCTCCTCAAACTGAG