Description :
From Genome Similarity Track
Location :
Scaffold_80:62246- 65176
Sequence
2930 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGAGCAAGAGACCTCGCTTCTTCAAACAACAAGCGATTGCAGAAGTGCAACCACTGCCAGAAGTTGGGACACTACG
CTTATGAGTGGAGTGCCCCACGCCCAGTACCAAACAGTAAAGAGCGAAATGATTGGCCATTTGCCAGAAAGGACAATGGGCGTAGGTCTAACGCTGTTGC
GGTTTCGCAACAGCGATGTGGACCATAAAAGAATGGTCGGGGTCAGTAGGGGCAGAGCGACCTACTGATCCAGCAACCTCAAGAGAATTTGCGAATCTCT
TGACGAAAGTTGCTCCAGATACACAATCATTGTGTGTCTCTGCACCTGGTGATGAGGTATCACTCATCACCTTGGAGTTGAAAGCGACAAATGATTTGTC
ACTTCGTTCTCTAGTCGACTGTGGTGCGTCGAACAACTTTGCTCGTCGTCAGTCGCTAGAGGTTCGTAGGATCAAGTTCGTTGAGCGCGACATCCCTTAA
CTGATGATGAAGGTGTGCCTTGCCACAGGCGCGTCGATAACCGTTGAGAAACGTGTAGTTGGAATTCACTACACGTTAGAGGGTGAACAGTACAATGATG
ATTTCATCGTAGTGGATCTGGATGAAAAATTTGATGTCACCCTGGGATTACCCTGGATCAGAAGATACGAGCCAAGGGTCAGCTGGCAGCATCGAACCGT
GAAGAGGCCTGCCACTTGTTCATCAGATGGCCATCTGATGAGCGTCATGGAGCGTCCACAAGCGTATGGATGAACTGCGAGTAAGTGCGATGGCCTCACT
TGCGGTACGGTCGTTAGCACGACTGCACAATATCACACTGTGACAACCAACCACACTGTGGAGGAAGCTGCCGGCGGTTGTGCGGATGCACAGGCAGCGC
CGAAGGTCTACCACTCGAATAAGTCGAATGGACCGGGACATGGATCCATGCCTGTCGGGCAACATCCTAGGAAGTAGAAACCGGTTGCCACCAAAGGGCA
ACACGGTTATCCTTGGTCGACTGGAGAGTCGACAGTAGAGGATCGGTACCCGACTGTGGTTGCACAGCCACAGTCAGAAGACGTCGAGGGAATAAGTCCC
CACGTACTTGAGGAAAGGAATCCTCAAGAGTTACATGCTGAGAGAACAGGCTCTCAGTAACCCGAGGAAGCAAGTTCCCAGAAAGAAACCGAGATATTAA
AGGTCTTGGTCAATGCCGGATCAAGCGTAGGTGCTTATACGCTTGATCTGATTGTGCCTCCGAAGTTGAATTTGGAGATCCCTCAATTGCCAACGCTAGG
ACCAAAACGGTTCTTGCGAGATCTGCGTAGTGGCAAGGTCAAGCAGATCTGTGTACTCGTCACGGAGGAAGAGTTCGTGACTGACATTCGGTCGGCAGTA
GAATTTGCTGAGAACGAACGGGTTCTCAGCAGCTCATCAATGGACGAAAGTGTACTCGATGAGAAGACTCTGGTTGAGCGATACACGTCTCAATCTTGGG
AGTCGCTTCAGGCAAATCCTTTATTTGATCGAATTCGAGGACGTGTTCGCTGAACCCGTACCATGCGAATTGCCTAAGGATAAAGGCACTCGACATGAAA
TCGAGCTCAAACCGGGCTCGAAGTACTGTGTAATGAAGCCGTGGTCACTGCCTCATGAACNNNNNNNNNNACATACGTTTTTCTGATCCCACTGTCACAA
GGGAAGGAATCGCACCACACAAATTGCAAAGTAATGCGTTGCGCGCGTGTTCGCTGGGCCCTGATGTAACCTGGAATTCTACACGGCATGGCTGCACTGA
CGTCTTGTGTCATACCTGGAGTAATAATACAGGAACCCAATGGCCTCCACAAGAGAAGAGTTTTCTTCGCACCTATCCCATATGGACCAGCTGCGCTGGC
GGATACCCCGAGCGCTCATTTATGCGTATCTGATCGGGTAGAATTTTAAAAATCGTCCGGACGCATCGTTGATGACGCGATAAAGGACCTTGATGCATCG
GCTCATCGTTCAAATCAAACCGGGCGTTGC