Description :
From Genome Similarity Track
Location :
Scaffold_22:62239- 63823
Sequence
1584 bases(100 bases per row)
GTACGTAGCGACCCTGAAAGCTAATTCTAAGCGAGACCTCCAGATGGTTGTGAAAGATTTTAATATCAAGGGAGTAGATGAGCGTTCAATCGTCTATTAT
TACAACAAAGCCACGGAGCGAAAGGGCCAAATGCTCTTCAGTGATTCGGTCAAGGGTCAGATCAGGTATAACTTCGATAGACCGATTCGTATCGAGGACT
AATTCCAATTTATCAAACAAAAATATGCCTACAAACATATAATCAATATGTCCAGCTTTATCAAACTCGACAGCACCAATCTGGTACAAGATGGAACCAA
TTCAACCTGGAAATACTCCTTTCCCGGATCGGCGGGTGACTTCCGCGATGTAGTATGTGCCATTCAATCGATTTCGATTTGCATTGAATCAATGTTATAC
TCGATGTATGACAGCGAGTATAACATTGATTCAATGCAATTTCAGAACACAACGTTCAAAATCGAAGTACCTACCGCTGCAACTACATCCACAATCAGTG
TATCCCTCTCTGATGGTATTTATTCGTATGCCGATATCAACCGAAGCATTCAGACTGCTCTTGTCAATGCTGGGGCGTATCTAATCGATCCGTCGGGGAA
TAACGTAGTCTATATCAAAATGAGTGCTAACAGTGCTTGATTTCTCTCCTACGCCTACAACTCTACCAACTACCGGTGGAACATGGACCAGACCTACCTC
CGGTTTATACTCCTCTGGTGGTACTGGATTGCCGACTACTACTCGCGTTCCTCGACTGATCATCGATAATGCTGAATTCGGTAAAGTAGTTGGTCTCACA
GCGGGTACATACCCCTCCACATCAGCTACTGTTGCAAGTGCTCAGCTATCGAACATCATTCCTCAGATTTACCCGACCAGTTCCTACATCGTTCGTTGCG
ATCTGATCAAAAACGAATACGTGGCTTCTGGTGATATTGTCAGTGCTTTTGATAGAGGTGATGCCGCTATTGGAAAGGTCATTTCATACAAACCGAGCCA
GTATGCGTGGATGAACTGTCATAATGGCGCTCGAGCTAGTATTACACTCAGTATCTATAAACAAAATGATAAAAAAGTGATTTTCAGAGATACGTCGGTA
TCCATCATGCTTCTGATTCCTCCAAAAAAATAAGACATCCAGAGTATTTTTGTGTAGGGCGGCTACAACGTAAACGAACCACCAGTCTTACGACGTGCCC
TGAGCGCAGCCATCTTAGCCTTCATCTCTGGCGAACCCTTCGCTGGACGTTTCTTTGCTACGCCTACACCATAGCGGCGACGAACCTCCTTTCGCACAGA
TCTGATTAGATCCTCATGTTCCGGCTTGGTAGCTTTTGATAGTAGGAACTTCTCTCCAGCATCGACCGCGTCGGTGATGACCCCCTTGCGCTTCGTGTAT
GCAAGAGCATTCTTTGCAGCCTTCTTTACGTCAGCCATTGATACGCGACCTCCTTCCTTGTCGCTATCGGAATCATAAATACCAATGCCGGTTAGGGACT
TGATTGCAGCTCTGGCTGGAACAGCAGCCGTTGGCTGATCAGCATAAGTAGCTAAAGCAGGAACCGCCGCATCAACGGCTCTGG