Description :
From Genome Similarity Track
Location :
scaffold_34:622331- 625010
Transcript NameFunction/comments
g9235.t1 malate dehydrogenase, mitochondrial precursor

Sequence
2679 bases(100 bases per row)
CACAGGCAGATCATGCACCCCACCGACGTCGTGTTTGGGGGATGTAGACTGGGGTTGCTTTTGCTCACGACGACTTGGGAATTGTCGACGAAAATCTGCA
GGAGCGACCGTCTATCGCTGTCGTTCTTCACGCCGAGGAAGTCAAACAAGTTGATGGGTAGATTCTGGCGGGCTTGGAGGCATTTCATGGCACTGCCGGG
TAGAAGTACACTGCGGAGTAGGTGAGTCAACACGAGCTCAAACTTGCTCTTGCGGCTGGTGATCGTGCCCGTTCTCGTGGATATTATCCGTAGGCGCTTC
TTGGGGAAATAGATCGACACGATGTCACGCAGAGCTTGACATGAGCCGGCGCAGTTGGCGTCGTGGCACGTCCACAAGTCTTCAAGTTTTGCCCGAAAGT
CGACGAACTTTGAGTATCGGTAGGATATAGTCCACGTCCTCTTGGTTGTCGCGCTGGACACGGTGCAATTGTAGACGACACAGTCCGTTTCCATCGAAGC
CGACGAGACGCGAACAACAAGTGGCAATTCGTGCTGCACGTGGAGGCGAAGCTTGCTGAGTGAGTGCCACTGGTGCCGGTCCTTTGCGGGGATCCTTTTC
ATGAAGCTTGAGGATAATTCTGGAGGGTCCATGGTAAAAGCGAAGACGACACGTGCAGTGGCGGCGGTAAATTGACAAATGAATTGGCGTAGGAGGTCAC
ATCCGGATCAAAAAAATAGTTGAGTGTGCGTGCAGTGGGTTCGCATCCAGTGCACCCACTTCCAACGCTTGCTACCTATGGGGTTCGTGCGAGCTGCACG
CAGCTGTGGGGAAGAAATCCTCGTCGCTGCTGTCTGCATCGGCGTCTTGTTGTTGGTTTCCGTGTTCCAACTCGACACTGTTCAGACAGATTGTGCACTG
CGTCGTGTCCGACGAGTTCAAGCTCCTCGCGTTGAGCTGTTGGACATCTACCGAGAAGTTCTCCATTCCATGATTCTCGCCGAGAACCATGGAATGTGGC
GCTGGAAGGCTGGAAATCGAATCCCAATACCCGTGGCCGCGAAAGAGTGCGCCACGATGTCTCGGGGCGCTGTGCGGGCTTCTGGTAACTTGTAAAGTGT
GTTTTGGCTAGACTGTGGTGTAGCTAGGTATCTACAAACTTTTCTGGAGCAGTATCCATTGACATCACACTCAAATCCCGCTTTCATCGTTGATTATGAT
CAAAAGCAAGGGCTCAAAATGCAGTACGAGGGGTCAACTCGTCGGAAGGATGAAGGAGGGGGGTTGGGTCTGCTCTTCGCTAAGCTGTTGGTGTCGCCAG
TGCTTTCTGTGTCAGGTTCTTGTCCGGTTGCACTTTGTTTAGGCGGATTGTGCATTGTGTCCTATGATAAGTGCCTTCCATTCTTTTTTCCTATAGAATC
CTTTTGATAATATAAAAGACGTGACTTGATGTCATCCGTCTGTCTTGGTGGAGTTGAATCTGGTTGATCTTGTAGCGTGAAGTTGGTGAGGTAGTCCTGC
AGCGGAGCCGGTGTTCTTCTTTGTTGTTGGAGATAGAATGTGCGTGTTTTGTGTGTTTTCGCCAGTGTCCGAACTGCTTCCAGGTCGTGTTTCGCTGGTG
TGCTCCATTGCACAACGAAAAAACGCGGTAGCTCTTGGCCCAGTTCCTGGGTGTTGCCCGTGTTTGTAGTTGTGTCTGGATTTGCACTGGGGGTCTTCTG
AATTGTTTTATCCACACTAGATATGTCTTTGCTGCGTTGCCTATCTGTTTGAAGGCTTGGAGACCATTGTCTAACATTTTCATCGCGTTGATGTGTCTGA
TGTACATGATATTGAATTCTCCATTTGGAGAGAGCTGGGATTGGGTTTGTAGAATCGATAGCCATCATGATGCTATGACAAAGAGATTGCTTGTTGAAAC
CGGATTCGAAGAGGCTGTACTTTGTAGTAAGTTATCCTATTGCTGGCTCACGAGCGAGCTACTAACGTGTGCAGTAGCAGTTTGGTGGAGCACTTGGCAA
GGAGTTGCTGCTTGTTTGGAATTCCGTCAAAGCAAAATCGTGGCGTTTGGATGCACGTCTGGACTCAGGAGAAGGTGGTTTCCGGCAATGGTGGTGGCCC
AACTTCGACAACGATCTTCACTCCTAACCAGAATGAATGCCAACTTCAACTGCACATTATGTGGACCACCTGATTATACGTATTCAACACGAAATAGCAA
CATTACGTCCACGTTTTGAATGGAGCTCCTCAGTTTTCAAGCAAAGTCCCTCGTAACTATGGCCTCTCGAGTGTGGACCGCGCCGTGCAGAAGCTGCTAA
GCAAGAATGAGTTCCTGGAGCTCGTGGAGTCCGGCGAGGGCAACAACAAGCGCGTGCGCGTCAAGTGCCAGCTGACGGGCCACGAGATGCTGCCGCGCGT
GGACGTGATCGAGACGCACGTCAAGTCCAAGAAGTTCCTCAAGGCGCGCGACTGGTACTGCCACGACTACGCGCAGTACGAGCCGTACATTGTGCCGCAC
CGCAGACTGCCCAAGAGCCTGTTCTGCAACGTCACGGGCACCATCCTGAACCGCATCCCGTCGGAGGTGGAGAAGCACGTGCAGGGCAAGCGCTACAAGC
GCATGAAGCAGCACGTGAAGATCACAGTGAAGAAGAGCGACGACGAGGAGGAGCTGCAGGGCACTGGAGAGTTCGATGC