Description :
From Genome Similarity Track
Location :
Scaffold_175:62233- 65564
Sequence
3331 bases(100 bases per row)
AGAGGGCTCGTACTGATAGTACGGGCGGAGACGCCCCAAGTAAAACGTAGGATGCGTACGCATCCTACGCGGAAGCTCGATCGTGTATGCGTTGCCTTGT
CGGCGCAGCACACGAAAGGGGCCGATGTACTTGGGCAGTAGTTTACTGCTGCCCACGTTAGTCACTACGTGTCTAGGTAGATTTGCCGTCAATAGTAGGA
CTAAGTCGCCTTCAAAAATGAAAGAACATGTGCTCTTCCATTCTTGTCAGCGTTCCGTTTCTGCAGGTCCACCGCGTGAGCGATGGAGTCCGGCACGAAA
CGGACCACTGCTTCTCGAGCCAGCAGAAATCCGTTTGCTGACGAGACATGTTTTGTTCAGTTCACCTTGTGCGAACTGCAGAAAGAGTTCTTTCCTCTTT
CTATTTGTCAGCGAGGGTGTCATCATCCTCGCTGGAATACTCGTTGGCGATGCTGAAAATACCAGCATCGTCATCATCATCTGACTCAATAATGGCGTTA
TCGCTATTATTGAGATGATCTTCTTCTTCGATGTCGACCTGATCGACATCGGCATCATACGTGACGACGTTAGCGTCGACACGTGATGAGCAAGATCCAG
AAGGTTTTTGCTCAAGCGAGTCCCTCCCCCCCTTAACCAAGAGTCACACTCTAGTAGGGTGGGCAGACGCGGATGGCGTAAGATATTCACGAAGAATGGT
GTGTGCTGGGTTGACGCATGCACCGAATTATTGATAGCAAATTCCACCATGGGGAGGAATTCACTCCAACTCGAGAACGAGTGAACGTATCCTCGAAGTA
TCTCTTCGAGGACACGGCTTGAACGTTCCGTCTGACCATCTGTCTCGGGATGGTCAGATGTTGACATCTTCAATCGCGTTCCGTGTGATCGGAACACGAA
TTGCCAAAACTCCGCCGTGAACCGAGGGTCACGGTCGGATACGAGTTCAAGGGGTAACCTGTGGAGTCGAAAGATTGTGTCGATGAAGACACGAGCACAG
CCCTGTGCCGTGATTGACTCTGGTACAGCAGCAAGATGCACCATCTTTCTGAACCGGTCCACGAACACAAGGATACCATTATTCTTGTGAGCGTCTTCGG
GAAAACCGAAGACGAAGTCCAGGGAAATGGACTGCCAGCAATCTGCCGGGACAGGTAGAGGCTGTAAGGGTGCACGGGATGAAGGACAAGGCTTCACCCG
TTGACAAACCTCACAAGCACGAATGTACTTGCGTACAAACTGATACTGGCGGGGCCAGTAAAAGTCACGACTTACCGAAAGGTAAGTCTTGTCTCTACCA
CGATGGCCACCTGTTGGGGCATCGTGACACTCATATATGATGCGCAAGCGCAAATCGTTATGAGCGGGGACGATGACACGAGGCGTGTCGCCGGCAACGG
CTGTATAGTACAGCAACCCGTTATGTGTTGTGTACCGATCTGATGAGGAACGGTACAAAGCCGATAAATATCTCAACGATTTACGAGTTGAATTCACCAA
ATGATCCTTCAATCGCAGAAGATCCTTATCTTCTGTGTAGGCCTTTCTTACGTCGTCAAGTAACGTTGACGACGGGACACTTACTGTAAGTGTCGCAACA
GTGGGATTCTTCTCACTTTTGGATTGCGCGCCCGGCTCGAAATCGGGTCGCCGCGAAAGCGCATCAGCGACGACATTCAGTTGTCCTGGTTTGTACTCGA
CGGAGAAGTTGTACTCCGCGAAAAAGGACAGCCATCTCGCCATTCTTTGCGAGAGGTGTGGACTGTTTACGGCTTTGCGTAGTGACGCATGGTCCGTATA
GACGACGAACGTTCTATCTCCCAAGAGATAGACACGAAACTTATCCAGTGCATATTTCATGGCAAGGTGTTCCTTGTCATGCACTGGGTAATTACGCTCA
GCTGCTTGCAGCTGACGCGATTAATATTAGATGACGCGATCTGTGCCATCTGTATTAAATTGCATCAACGCACAGCCGATTGCAAAATCGCTGGCGTCAC
AGACCACGTGTAATGGTCTGTCCTGATCTGCAATCGCCAGTATGGGTGATTGCATCAAGCTCTGCTTGATACGTTCAAAGGAACGCTGACAGTCAGCGTT
CCATGACCACTTCACATTTTTCTTGAGTAGATAAGAAAAATGCACCGTCATCTCGGAGTAATTGCGCGAGTACTTGTGCAAGTACGCCGCTAGCCCAAGG
AACTCTCTTAGTCCCTTGACATCGACTGGTTCAGGCCAGTCGGTGATCGCCTTGATCTTTTCGGGATCAGGGCGTACGCCGTGTTTAGCCACGATGCACC
CAAGAAGTGGTATTTGGCTAGCCGCGAATATACACTTCTTGAGGTTGGCATACAACTTATACTTCCGCTTAAGTTGAAGAACCTGACGAACGTGTGTTCT
GTGAACTTCCACGTCCGTCTTCCCATCCATAGCCCGGCTATGGACGAACTCATCTTCAAACTAACTAGGTGCGAAGTCCCACACCGGTCTCAACAGATTT
GTCACACATCTGTTGAACGTTGCAGGGGAGTTACTCAGACCCTGTGGCATCACTAGCCACTCCCACAGTATACCGCTGGGGGTCAGTGCTGTGTACGGGA
TGTCCCGTTCACGCATTAGGATATGATAGAAGCCATCCATCAGATCCATGGACGAAAAGATAGTACTTTTTGACATACCATCTATGATTACGTCCTTCCT
CGGTATCGGCGTCTGAGCCGGTACCGTTGCAGCATTTAACTTGTTGAATGCGTGCACTATCCGCCACCCTTCTGTGGCCTTTCGCACACAGAAGGTCGGA
GAGCTGTGAGAGGAAATTGATTCCCTCACATGGCCCGTTGCAAAGCGATCGGCAAAGAACTTGTCGATCGCTAGTACTTGTTCACGAGGCAGTGGCCACT
GCTTCATGACACAGTACTTCGAGCCCGGTTTGAGCTCAATCTCGTGTCGAGTGCCTTTTTCCTTAGGCAACTCGCATGGCACGGATTCAGGTTTTGCATA
AGTATTTGCCTGAAGTGACTCCCAAGATTGAGACGTGTATCTTTCAATCCGAGTCTTCTCATCGAGGACACTTTCGTCCATCGATGAGCTGCTCAGAACC
CGTTCATTCTAAGCAAATACTGTTGCCGACCGAATATCGGTCACATACTCATCCTCTGTGACGAGTATGCAGATCTGCTTGACCTTGCCACTACGCAGAC
CACGCAGGAACCGTTTCGATTCCAGCGTTGGCAATTGAGTTATCTCCGAAGTTAACTTCGGAGGCACATCCAGATCAAGCTTATAAGTGCCTACGCTTGC
TCCGTCATTGACCAAGACATTCAATATCTCG