Description :
From Genome Similarity Track
Location :
Scaffold_122:62231- 64889
Sequence
2658 bases(100 bases per row)
ACTCGATGGCATAAGTAATCCACCTTGCGCATCCCACAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCA
CTCTGTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGCCCCAGGATCCCCTGGCTC
TCCTGCTTTGAAGGGATACTTCCGTATGATCTTCACCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCG
TTGGTAGATCTGGGGCGCATTCTTCAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCGAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATAC
GTCATAGTCATCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGATTAGAGGCATCGGAT
ACACCATCAATCGAGTCAGGCCGTTAACTAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCA
CGGGGATGTTGAGAAACTGATGATCTTGGCTTGCAGTAGGCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAG
CGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTGCCCTTACCGATCAGCAGATGTCGGCTTTCCCA
GATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCC
GGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTTTGTCTAATCCACCATTG
GATCCAAGCACCGCGACCCTCTTTCATCTGGCAGTCCTTCTGTCTTCGTGGGATCAGGTACCCTGGTATCGGGGAAGCCACCGGTTGGATCTAGTCGGTC
CTCTAGCGAGTTTAAACCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAAGGATCCAGGCACCTTGCCCCATGAAAAGCTAGGATCCACTCTG
GGGTCAGCGGGGTCTGGCGGTCCGGCTTCAGCCTTCGGCGATCCTTCATCCACCGATCCTGCGTTGTCTAGGGGCCGACTCTGGGGATCATCCCCGGTCT
TGGATCCAACCTCCATCGCTTGGACCTCCATCCGACGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGG
CCCCGCCGGGAGGTTCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACGCCAGATTCTGCCATTCTCTGTAACGACGGGATCCCACTGACACA
TATCCAGGTCGCCTAGGGATACCGTCCTTCGTCAACCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGCTCGTGACCTGGA
GGTATTGCGATCGACCTCGTCCCCGGATTACGGTAGGCATCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCATTTTAACCGATCTGG
CAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCGTACAACGGTCGCCGTCCGCTGAGCTGGATC
CGCATCTCGTCAGGGAAACAAAGTTTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGTACCATTAAATCCATCACGAGGATGGAGTCTTAACCAGCGA
GATCTCCAACTCAAACATCGAACCAGTATACCAAACAACCTGCCAGCGTGATCTTGATTCGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCC
AACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTCACGAGCAAAGGCTGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAGTAGG
ATTGCTTTTTTATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCA
GATCCATGGATCCAACATCGTCCGATCCACGGGATCCAGTAACCTGACCGACCTTAGGTGGATCTGCAGTGACCTCATCCTTTGTGGGCTCAAATCATCG
ACCATGTTGGCGTTTCTCCCAATAACCACGTGCCTCTTCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGAAAACTCATCCACTTGGCGCAAA
CTAGAGACCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGATCGGCTACCTGGATCTAGCGATGTCTTGTTCACAAATG
CATAAATGCAATACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCTG
TGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACT