Description :
From Genome Similarity Track
Location :
Scaffold_97:62226- 65567
Transcript NameFunction/comments
Phyca_LT1534576860predicted protein
Phyca_LT153447919conserved unknown protein

Sequence
3341 bases(100 bases per row)
gcgatggcgagcagcggcgtggatgtggccctggcgcccaactctagcgtgatcttagagccagcggactcgttgtccttccaccttcagcctcaaacgg
cgccccaggcggtgctgacgatccgcaacgtggcggatgaccgacagatcgccttcaaggtcaagaccacgcggcctttgcgctacttggtgcggcctaa
ccaaggtctgttgggccctaatgggtcggcctctattatggttatcttacagcagaaggactgcgacgagctgctgcgtctggacccagcagagcgccaa
ttggccaacgacaagttcctggtacagagcatctatgtggacgacagtttctatgaactggtgaagaccaagagcacgaaggagatggcggacgagctga
ctaatatgtgggcacgcacggataagcgcgcgctgtccaacaagaagttgcgctgtcgattcgtgcaggacagcgaagatatggggcgtccgagttctcc
acccagtcctcaacgagcgccatcggctaatgcttctcctgccaagacggcagctacgtctgacacgagataccagactagacagagtgatgaggccagg
gaggaagtggctacagctgcacagctttcgtctgcattgctgcaggatgacaagccccaggcgcctaaagtggcggagaacagggaaggaagcaaggaag
cgatccaagaagttgctgcactgcgcaagaaatacgacgaggtacgtgatgcttgtagataacgtggtggtgagaggtggtggctgatattttcttgatg
tgaacgttctagttggtggcatttacagtgcagcttacggcgcagcgcgacgttctgatgagcgacctggacaagacccggcaactgctgcaaaaggcga
gcacagatgctcagcgcgtgaagaagctctcagaggagtcgacgggtttgcgtcatcggaaaaatggtggtgccactggtgcgtctggtagcgaagactc
gcaggcgattacgagcaagggatcgattgaacaaggggttcgtgttactgtcagttgtgctgggggatctcattgacaggttctaatggttgttttggac
gatgtgtttgcaggctttcggaccgttgcatctgctggtgtgcgcgatcattttcttttagttgggcgctactactaggtcagctttgctgtgttggggg
cactggaatttaggcagaggcagaggagagggtgtactgcacttcagacgtgtgatgatagaggaagcagcagtccggagagcattagagttttctgtcg
acctgcaagagacgctgacctgcgttcacacgtaagtaggcttgtagtacgaagtagctggaacactaggcaaattgggggcaacaaggcaatcaggaaa
atgaatatggcaacaaccggttggaaaaagcctttcagaaactaggtggtgcatttgatgagcccgcagatggaccacaacctgtccttttgattgacac
aacagtaacaggcacttctgctagttcagaatcgcggtgacgctcattttgcgcttcccttccatatctagcggcgcacaggctttgcgcttcgcactcc
gggttcggcagctctccgtagcactgtcaccaccatcgctgctgattccagacgtgcgcagacccgcgctatctttcattgaaagcatagcaattgctgc
agcatcgctgtcggattgggtactgactggggcgacacgcaacggcaccggaggcagaatgctcttctcttcttggggtcgaccaccaaaacgcaatggc
ggcacttctgtatcatcgtcagggaaggcactgtcgtccgcgttgtcctcgtactctccgtcgccgtcatacgcgctctcaatctttcggagttcccgca
catcatctcgaagcgcattcactcgaactagtgtcactgattcttcagatcttggggacgagtcatctacagcgcctctataccttcgtccgtcgtgacg
gccgccgctagcaccgggtggagtgtgacttggcgagtgatccgatgcgtcattgttgccaaatgaggagtttccagcagcaccagcggtaggacctgag
ctgccaggtgcttctcctgaaggcgacgaggacgagctgccgccgccaccacgtcgagaagaagatttttgagcgtcatgctgttcaatgctcgagcccg
ttgcctgcatgaaaatgtgctccaaacggtcgatcatctgcaacagcggctcgtacgtcgcgaaaggctgtttcatcaggattgtgtgcatgaacttgtt
gcgtgtggcatatcccgtccacttatcgtgttttttcaagatctgtaagacaaaagacactaaacaagttagcaatagcttgtggagatgctgtcagggg
acgaaccgcctgaatcagcatcagagcgcaatgggtttaggatctgacctggaaatgccgcagaagttcatcacggcaaagttttccaacagcagcaatt
ccttgtacagcgcgacgcagctcttcatgagcgctgttttagcttcagctgactcagggttcgtctaagcaacgcataacaaatttgttagacttttgtc
tcgatgattatcgcgttgcacagtgcagtgcactaccgacggcggtaccgttcagtagtcaacccaactcttacctttaactgctggaagctggcgtcga
tagctgccacttgacttgtatgcttggcctgctccttaataaagaagtctgcgatcttcttgatctccacacgcaacgtccggaaaaagttcatctcgtc
ctgcgactggcctgatgccacaacaatacggtgaatttcaaaacgttaacagttgaaagcatcaactacgtacggatgctgtcattgtcctcctttgcag
acggcttaatcttgatcttgacaagcttgtcaccctgcagcttctcctctttcttgatctgtgcgcagtccttgatgatcttcttgagcagcttgtagtc
ggcccagtagggctcccaggcactgggcgacatttgcgtcgactgctgcagcactttcccgaacttcatgtcgaactcagatctataatagtgtcccgta
cttcttcccacctaacttagaagtggtaagtggtgcgtcttctgtgacaaaaaacaactgataaccaaccagtcaggtccaatgcagttcagcgcacaca
ctcttcctaggccacgcagtgcagagcgcagtggagcggggcaactggcacgagattcgatgcagaaacgaggagaaaacacctgctcgaatctttcagt
ccaacagcctctcaaagaagcagcgaatcttggctcgacaa