Description :
From Genome Similarity Track
Location :
Scaffold_12:62220- 64588
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04585ribosomal protein S5 domain 2-like superfamily protein
Sappa_CBS223.65SPRG_04586U4/U6 small nuclear ribonucleoprotein Prp4 putative
Sappa_CBS223.65SPRG_04587Hypothetical protein

Sequence
2368 bases(100 bases per row)
CGTCGCCTTCTCCTGGCGCCGCAGCTTGGCCGCCGCGGGGCCCGAGACGGACGCCAGCACCGACGTCGTGCCATGGTTGAAGCGCGCAGAGCCATCGGCG
CGGTTGAGCAGGCCTTGCTCGCAGGCGAGCGGTCGGATCTCTTGGACCAGTCGGCCGTCCTCGCGGCGATCCGGCGTTGGCATCTTGTAAATAGTTGGTC
GCTAAACACAACTCTTTTTAACCAATCAAAATGCACCAAAACTCCGCCAATGGCCGTGCGCCAAACGCGATCATTTGTGAGAAGCAGGATTGATTACATT
AGCACTCGCGGGCCGGCGCCCAGGTCTTGAAGGTGCGGTCCCAGCCCGCCGAGACGTAGTGCGTCTCGTCTGGCGCCATGTCGAGCGACATGACCTTGCC
GTCATGGCCTTTCAGCACGGCAAGGCAGGTCCAGTTGCGCGACCGCCACAGCTTCATGGACCCATCAAACGACGCCGACGCGAGCACCTCGCCCGACGAC
GAGTAGCACACAGTGGACACCATCGCATCGTGGGCCGGCACGACGTAGATGTTTTGGCGCTTGCGAAGATCCCAGACGCGGATCGTGTGGTCGTCACTGC
CCGTCGCGAGCACGTGGCCGTTGGGGTGCCAGCTCATGGACACGATCTGCTTGGCGTGGCCCTGGAGCGGCAAGATCGCTTTCCCCGACCGAATGTCCCA
GATGCGGCCGAGGCCATTGAGGTCCCCTGTCGCCATGAGCGCGCCGTCGGGCTGCGCCGCGATCGCATAGACTTCGCGGTAGTGGCCTTCCTGGAAGAGG
AGCTCTGTGCCCCGCTCAATGTCCCAGAGCCGCCACGAGTGGTCGAAACTCGTTGTCGCGAGGTACGAGCCGAGCGGATGAAACGCGATTTGGCCCAGCC
TAGTCCCCAAGCTTTGAAAAATCCAAGTGAATATGGAGTTGTGTACCGGTTCTGGTGCCCCTTGAGCGTCATGGCCAGCGCGTTGCCTTTCCAGATCTTG
GCCGTGCCATCGGCCGCGCCCGAGGCCAAGATCGGACTTTCCGTCGTCGACGCCGGGTGCCAGGCGAGGCCCGTGATGCGATCCGTGTGACCCGTCAACG
TGTGCACGAGGTCGCACGACTTGCTATCCCAGATCTTGACGTTCGAGCTCCACGACCCTGTCGCCAAGAGACTCGCGTCGGGTGAATACTTGACATGCGA
GAGCGGCCGAACGTCCGCGAGCTGACTCGCGTTCAGGCTCGTCTCTTGCGCCTCGCGGTACAGCTGTGCCGCGTGCTTGTCGGCATCAAAGACCGTTCCT
TCCATTTGCGCGCGCTCTTGCTGGAGCCGCGCGCTCGTGCTCACCATCGAGTGCTTGAACATGGCGTGGCGGGCGACCTTGAGGTCATTCGTCTTGAGCG
GCACGTAGAAAAGCTGGTCTTCGATCGCAACCTTCTTTTCCTTCTCGTACCCGACTTGCTGGGAGGCAGCAGCGTTCGCTTTAGCCTGCGCCGCGACGAT
CGTGTCGACGTCGCCCGCGAGCTGGAGGGCACCCAGAAGGTCGCGAAGACGTGCCCGGCGATCTTCGGGCTTCTCGCCGAACAATGTGATGGGCTCACCG
AGGCTACGCAGCTGCTGGATCACTTCTTCCGTGCGCGTCGGCACTTGAATCAAGCGCGCGCGGCGCTCCGTCTCGAGCCGCCGAAGCTGCTCCGCATGCT
TCTCCTGGGCCAGTCGACTCGTCTCCGAGAGCTCAAGCACCTCCTTCTCACCCGAGTTGCCCGTGTTGATGTTACCCGCACGGATACCGGCCTGAACGGA
GCTAGAGCCTGCGCCGACGATGCTGCTCGCAGAGAGCGCGCCAAAGTGGATCGTCGATCGCTCGGCCATCGCTGCTGCTGGTCCTGCAAACAATGGGACC
GCTCGCGGCTTGTTATCCGGATCCGGTAAACTAAAACCCACGGTGGGATTTAACGTCTCCATGGCATGCCCAAAGCACGTTAAACGATATTGCTTGCGGC
CGGTACTGGCCTACTGTATGCAAGGGCAGTGAAGGCAGCTTCTATTCCAACGGCAGTATCTGATACGAGGAGGTTGAACGACTGTCGCCATCGAATGAGC
TCGTCGCATCCTGCACAGCACCGTGCTGTCGATCGTGTTGACGCAAAAAGTAGCTTTAACGTTGTTTACGCAACGGTTTAAACGTCGTTGGTCAAACTCT
TTTCGTTCAAAGCTTGATGTTTGTATGCCAACCTCGAATCCATTGCGCGAGCTTTGGCGATCCAACTTTTGCATGTTCGGGCCGGCGTGGTTCGAAGCCC
ATCGGAAGCCGGCGGTAGCGCCCGTGGCCAAGACCAAGGTCCCGTTCGACCGGCAGGCCTTCGTCGCC