Description :
From Genome Similarity Track
Location :
Scaffold_833:6222- 7894
Transcript NameFunction/comments
Phypl_g11206hypothetical protein

Sequence
1672 bases(100 bases per row)
TTTGTTGGATGTTCTGTTCGATCGAATGTTCGAATTACCCGACAAGATGAAGACTGTTGCTgtaaccctttcgtggtaAAAGGGCGCACTTTTCGCCCTT
TTaccccccctccccctcgCACTCACGTTTTTTTTCGGGTCCTGCTTATGACCAATATACACCTTATTAAATATGTATACTGCATGTTGTAAAAGGAAGT
AACTTAAAAAAATCAATTGAGTGCGCGATATCAGCTTAGTGCGCGATGTAAGCCCTCATCCAATGGGAGCTCGGTTTTCTTAAGTATCGGCATCTAATTG
GCTAAATGGATGAGAGTCAATTCAGTGCACTGTAAATTATAAAGTTTTGCGGTACTTTATAAATTTATACACATTCGATTTTGGTGGAGGGCAGCGTTTC
CTCACTTCTGTTTTGACCGGCGCCGCACACCTCACAACATAAAGAACCAAATCGTGAACACGGTGATTTGTCGGGGCTGCTACAATAAGGAGGATCTGAA
CAAAGCTCTGGATAGAGCGTACGAGGGAGAAACATTCGCAGCGGTTGCACGAAGCTCGTCTGTGCCCCTTTGTACGTTCTTcaagaagtcgaaggaaCTA
CAGACCACTGAGGCGaccgtccagcagcgtcgagggCCCAAACCCTCTCTCTTGAGCAAGAGGCGGATGTGGTTGCGTGGGTTGCCGGcatgcagcgcgc
tggcTTCCCGGTGGGCCCGGCTAGGGTCCTCGAGCGTGTCAACATTATCTACGAGCGGCTACACGGTCCTACCACCCGTGCTAGAACTCCGTTCCAGCCG
CTGTCCATGGGCTGATACCAGCGCTTTCTCCACCGCCATCCTGTGCTCGTCCCGAGAACGACACAGAAGATAGCCCGTGTGCACAACACGGTGATGATCG
ACGCTGTTCGCAGCCTTTCCCCGCCATCGCAAAGTGCGTGGTGGAGTTGAAGCTGTCAGCAGGCCGTATGTTTAACATGGACGATACGTCCATATGTCCA
AGGGGATATTGTGCAAGGTGCTGATCCTCAAGAGTTCTACCAACGTGTGCAGTAAGGAAACAAGCCCCAACTTCCACATGACTGTGGCGGCGGTCGTTAA
CGCGGCAAGCTCCTGAGAAGCCGTCTAAGAAGGCTCGGCTGACGGTGGACATCGCAGGTGAACTGGTGTGCAACGAGGTCACTGTGCAGAGCAAAATTAG
ACTGTGTTCTCAGCTTGATCCCAAGCTACGCACTAAATTGATCACTCAAGTTGGCCATCGATATGCTCGTGTGTATGGCATTGTAGCGGTGCCTACAGTG
ATCAGATTAGTACATGCTTCGTTGATCTGCCTCCGCATCATCCGAGCTACTCAAAATGTATTGCTACGCTGCACGTCTTCGTTTTCGACTTCAGCTTATA
TCGCGCACTCAATTGATTTATTTTTAAGTTACTTGAACTTTGTATTGCCTGTGATAAATACAACTCATTTCTATGAACGACCAAACTAAAGTGTTGACAT
AAGCTAGCAGATCATCCAGAAATCGGACGAGACGCCCTGTCCTACTGACAACTCTTCCGATTGTTCACCCAACGCTGCACTTCCGTCTTTATCATCGGCG
TTGTCaccgccctcctcctcctcagcctcctcctcctcttcggccttctcctccttggcttcgtcatcggcc