Description :
From Genome Similarity Track
Location :
Scaffold_726:622- 3456
Sequence
2834 bases(100 bases per row)
CCAACTTCCGTAAAACATAATTCTAGCGAACTGTTGCACCAAAGACGCATCCCCGCAGATACATCCCGAATACGAGTTCCCTCAACGGGCTACGACTACC
ACACATCCATACCTTCCCAATCAAAGGGTATAATCGTACATGACAAGAAAGCGGGCGGCCCAGCTAGGATCATCTCACTATCCACGTGCGCATTACCAGC
ATTAAGATCATACTTCGTCATTTAGCATAATCGCGCGCCTTCGTAAAAGAAATATGATAGCGTGGCGATCATGTGCAATAAACGCAACTTAAACGTCATG
TCGGCGTCTAGGGTCAGCAAACCCTTGAGCATGGCTTGCATTTTGCTGCTTTCACAGCCGTCCATGGGTCCGAAGGTATCGGCTTATAAACTGGTGATGA
TGTCGTCTGTAGCGGAGCTACACAGCTTCTTAAGTCAGAGGAAGACCTAGTGCTCAAAGATCAATACTACTTCTAAAGAACTAGGCTCGATGAGTCAACA
AGCGTAAAGCTTAAGGTCCCTGTTCCAGGGAACCGAACGATTCAGTGAATCTACAGCACTTAGTGCTCAAGAGTAGCTACCTCAGGGAGGTGTTGCTAAC
CCTTAACGATCAACGATCAGCGACGCCTCGCAAGGCACGTGTCTTAGACAAGATCAAAAGGGGAACCGAACTTTATTTACATTTAACTCTATAGAATAAT
TTAATCCTAATATTACCTATCTAGCCACTCATGTACTAAATTAATATCTTTTAAGATCTTTCCTATCTCGTAGCTGACAACCGTCAGCACCTATAAGCCG
ATAAGATATTCTATATCTCTTTCAGTGGGATACCATCCCGTGCGTCTAAGACACAGGGTACCGAGTACCCTACGATGTGTAACCCCTTTACACCCTCCGC
GACCAGACTGTCGTTTACCCAAACGTCAATCGAACTTTGTTCCTCAACGAGGTCAGTGCGCTTGCGGGTAACCTCACGGTAACGGAAGCTTTAGCACCAT
GTCCTCATCGTCTAACGAGTCAAAGGCTCTTTGTGAATACCTCGGGATGGAGGAGGCAGTGAACTATGGTAGCGATACCAGTGTCCCGGGTGATGCAAGG
ACAATGTCCAATACACCCATGCCTGAGGTACAACCTCCTACTACGTTATTAAGTCTGTTCTCTAACCGTGAAGATGCGAATGCGCCATTGGCGCCGCATT
CAACACCCGGTTCGGATAATGCAATCATCACGAACCCGCTCAATGAACAGCAAGAGTTGGCCGTTCAGCGAGAAGAAAGCGCACGGCGCCATGCGCAAAT
GGTCACGACCCTTGAGAACCAGCGTGACTATGTGTACACTCCACTCAGTGTGGAGGAACGTCTACGTCAAACGACTGGCCAAACGTTGGCAACGTGCACC
ATTGGTCCTGGAGCTACTTCTCCCGAGGAAGTGGCAAGTGGCCGGTCATTTCGTGAGAGGTATCTGAAGCCATATCTGACAACACAAAGTCAGTACAAGT
CACGCCTTGCGATGCATGCACGTGGTGCACCGGTTCCACCGATTAAGGGTATACCCATTCTCGTGTTCGCAGGAGAAACAACAGACGAAGAAGCCGACGC
CTTCGTTCGCTGGGTGCACCGCACTCGTCGCCGCAGCAGTATGTACGTTCTGAGAGCTAGTGTCAGTGTGGCCGATGTGCGTCTCGAACGCAAGCTTCGG
TATGATTATGCCAAGCTTATGACCAGAGGCCAATGGCGCAATCGCACGCGCTATGGTTCGGTTACTACGGTAGCCGCGAGTGCTGGTTAGACTGTGACCA
CCACCCGCCAACCCACAGCACTAGTGGTGAGAAACGGCCTCGGTCTCGAGATGACACTGGCCACGATGTTCAAAAACATTCAAGTCGTATGGGCAATCTT
GCCGAAGGGGTATCTCGTACTCCGATGAGTTTTTTGACTTAGGGTACCCTCGCCACTTTACCAGTACTACTGAAACTGACGATTCCCATGCTCATCGAGC
AGCGTCGGGGGTGGCCAGTGTACCGGTGGCGGACCACAAGAAATTGGTTCTAGAAGTGAAGGATCTCCAAGAGAGCTTGGGTAAGACCCAGTGCATGCTG
GATGCGATGAAAATCCACCTTCAGGCGACGGAGCGTGTTCAAACTCGGGGCGAGGCTCAGTTGGACAGATGATTCGCTTACAGCAGTCCGGGGCATAGCC
CTCGTCGTCGACGCAAGCGCCTCGAAGTTCACATGAGAAGGGTTTCGGTATGGCTTAAGTAAGCGTACGTAGAACACTGGGTGTGTGCGCAATTTGCGTG
GAAGGTTGAGCGTATACGCAAGGTTCTTAGCAACGACCGTGAATTGTCCAATGAAGCGCGGACGCAACTTTGTCTTAAAGGCAGCCGACAATACATTTGT
AGGTAGGTTTTTAGCATTGAGTAATACTTGGTCTCCGACCTTATAACGTTCAATACAACCTCTGTTTTTAGCATCTACTTATTGTTTTTGTTGGTCTTGG
CGTTCAGCCATTGCGTCACGCACATGTCTTAAGACATTCGATCGCGTTGCGAGAAACTCTCCTACTTGTTTTCTGAACAGCAGGGCTGATATCAGCAAGC
CTATCGGCAACCTATCCCCCACCAATCCCTGAACCACATAGTGGTAGCGTTAACGGAACGCGAGGGTGGGTGACACCGTTTACGTAGAGCGGAGTATAGC
CTGTAGAGGCATGAACAGCGTTATTCAACGCAAACTCAACAACAGGGAGCATGGAGCTTCAACGCTTAGGCGTATCAGCGCAAATACTGAGGAAAATGTC
ATTAATGATGCAATTAACAAGCTCAGTTTGACCA