Description :
From Genome Similarity Track
Location :
Scaffold_80:622- 2490
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_80-fgenesh-gene-0.0NADPH:adrenodoxin oxidoreductase

Sequence
1868 bases(100 bases per row)
ACTACCAAGAGTAGCGGACTACACAAGACAAGGTGAGCCAAATTGAGATTAAACAATGGTGGAGGATATTAATTATTTTGGTATGAAGATTTATGAATAG
AGTAATATAACTAAAAAATTTTTAGCAAGAATTGCAGGTTTGCAGTTTCTATTGATTCTTAGATAATCCTCAAGAGATGGTGATGCGAGATCAAACAAGG
CGCTAATTTAATTGCCGCCGTGTACCGCCAGTTGCAGTTCGCGAAAAACATGCCTATGAGAACGTGCTTTTCACTTGGCTGAGACAAATCATGTGAAATT
GTTTATATCAATATATCCCCACAATACCTAAAGCATTCTACGAACTCTCGCACATAGCTCATAAAACTATTAGCACCTCTTCTTCTCTTCTTAAGTCTAC
AGCTTTTGAAACCAGACACAATGAACCTTTTCACACCATTTGCATGATCTCCGTACACACCACTGCGACGCTGGACATACTTTATTTGCAAGCTAATATC
ATGGCGCTTTCCCTCAATCAATCCCAGAAGTGGGTCGCCCATCCATCGAGTACTGTGGCTCACCAATAGGTGAAGCACTGCAGCGTGGATAGCTGAAACG
GTAGAGGAGGATGTATATGACTTCGAGTCTGTGAAGCTTGTCGCGACTCGGTGTAATGATGTAGTCTAGAAGCAAACAGCGCTGTCAAAATGAATCAAAT
GCACGCCAGTACAGGCAAAACTTACGACTTCATAGACTAGTCTGGTTGGTAGTTTTTTCTGCGGTCACAGCGTGCCTGCAAATCGTGAAGTTAGGTTTCC
AGAGATTTCCCACACAGTGAAAGGCACAATTTGTGGGAATAGAAACTGACTCCTGCGAAATCTGTCAGAGGAAACTTTGCATTAAAGTGCGAACATTTTT
CGTCACATACATGTGGTGTTATTCTGCATTGTACAATATTTTTGAAGTGCAGATCATCACTCCTGGTGATGCACGAACGTAACGGGGCAACAGGTTCGCC
GACGATGTCTGACCGAAAACTAACATGATTGACATCCATCATTTCATTTTCCGCATTTTTGTTTGGTACCGATTGCAACAACAATGATGATGATGAAGCG
GATCGCCCGCGGCCGCTCCACGGCGCTGCTGCTGCGTCGCANNNNNNNNNNNNNNACCACACCCGCAGCAGCAGCGTCCTCCGCTGTCTCGGCGCCATGG
ACGCGCACGTTCTCCACCGCCGACATCCCTGAGCAGATCCGCGTGTGCGTCGTGGGCTCCGGTCCCGCGGGCTTCTACGCAACCAAATACCTGCTCAAGG
AGCACGCGCGTGTGCACGTCGACATGCTGGAGGCGTTGCCGACGCCCTACGGCCTCGTGCGCTCTGGTGTCGCGCCGGACCACCCAGAGGTCAAGTCCGT
CATGAACGACTTTGAGAAAGTCGCGGCGGACGAGCGCTTCGCGTTTCTCGGCAACGTCAAAGTCGGCGACGATGTCTTCCTCCAGGAGCTCAAGGAGAAC
TACCACGCGATTGTGTTGGCGTACGGCGCAGCAGGCGATCGAGAGCTGGGCATCCCGGGCGAGCACCTGGCAGGGGTGTTGAGTGCGCGCGCGTTTGTGA
ACTGGTACAACGGCCACCCGCAGTTTCGGGACCTCCAGGTGGACCTCTCGGCCGAGACCGCGGTGATCTTTGGACAGGGCAACGTCGCTGTCGACTGCGC
GCGCATCCTGACCAAGTCTGTGGACGAATTGGCGACTACAGACATCTCGCAGCACGCCGTGGACGCGCTTCGCAATAGGTGTGTACTCTGGTTGAGTCTC
TCGAGTTTGATCAGTGTTGCCAAGTATTTTACTCACTCGCTCCTTTGTGATAATACTCATGCAGCAAC