Description :
From Genome Similarity Track
Location :
Scaffold_3665:622- 2420
Sequence
1798 bases(100 bases per row)
GACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCTTGCCCCAGCTCCTCGAAGCG
AGGGCCCGTCACAGTCGTCGACGAGGAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCGTGACCGTACGCCGGAGGGGCTCCATACGAACGAA
CCCCGGTGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCATCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGACTCCGGACGTGGCAACAAAGC
CTCGATCCGTCGGATCATGCGAAAGGCCTTGTCCAGATCGGTCGAAGAGGCCCGACGATCCACCCACAGGTGCAGGCTCGCGACCTCTCGCTCCAGCAGG
TCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGAATACCGGCCTTGGCGGAAGCATCGCCGCCAGTCCCAAGGCCAAGTGCAATCTCAACCACGAGGA
CACGTAGACGGAGGCGGTCAGCCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTTTCGGGAGGTGCCGAGTACTCGTACTC
GTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAGATCCACTTCCACGTGGAGCGGATCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGATC
CTCGTGAAGTGGAGGAATTATTTTCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTTCTAATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGA
AGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAATGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCC
GCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGAAAAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGAGACAGCAGCTGAT
CTTCATGGAGTTCCCGGAACTCCGTGGGTGAGTACTAAAGAGTCTCCACCCATGCCCAGAACATGTCCCCACAAGAACTTCACGTGGGACAGCTCTCGGG
CATAACCCAAGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGGCTCCTGATTGACTGCCCGAAGGCTGTCGC
AATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGT
GAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTG
GGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTG
GGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAA
TGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCTCCTAGAAGT
GTGGCCGCCCACAAGGCCACGAGGAGCGACAAGAAGCTCTAGAGAGGTCAGCTCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTGATGGCAG