Description :
From Genome Similarity Track
Location :
Scaffold_11:621983- 628906
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004955Similar to PE_PGRS54: Uncharacterized PE-PGRS family protein PE_PGRS54 (Mycobacterium tuberculosis)
Pytul_DAOMBR144PYU1_G004954Similar to PE_PGRS54: Uncharacterized PE-PGRS family protein PE_PGRS54 (Mycobacterium tuberculosis)

Sequence
6923 bases(100 bases per row)
CCACTCGTCACAGCAGCACCGCCACCACTTGTCAGGCGAACGCTCCCGCCAAACGATTGCAAGCCGTTGCCGCCTGAGACATGCACGTCGCCGCCGCTGT
CTGCGCCGTCACCCGCGATCACAGACACCACTCCGCCAGTACCACTTCCGCCAGTAGACTCCCCAGCGCGAACCATCACGGAGCCACCAACGTTTGTGTC
GTCAGATCCCACGATCAGCGAAATAGAGCCTCCCGGACCGCCCGTTGCGTTCGAACTGCTTATCGTCAGGTTGCCAGACTCTCCACCGCGAGAAACTCCG
CTTGACAAACTCACACCGCCGCTCGTCTGATCGGGACCAGAGTCCGCGCTCCCGATCCAGATCGCGCCGCTTGTCGCAGTCGCTCCCTCGCCGCTCACCA
CAATCACGCTCCCGCCGACAGATTCCATGCCAGCGCCACCGATCACTTCCACGTTACCGCCAACAGAGGTGCCGCCACCGCCATTGACTACCACACGACC
GCCGACGCCGACACGTTCCGTGCTGTTGCCTGACGCGACACGCACGTCTCCGCCTACTGCAGTGTCCCCAGATCCCACCGTCAAGTGGATCGACCCGGCC
TTGCCTCCCACACTGGTCGACGTCTGGATATCGATGAACCCAGAATCACCTCCAGTCGACAACCCCGTAGAAAAGAACAGCGACCCGCTCGTCTCCGTCA
CACCGGAATGCGCACTCGAGACAACAACATCCCCGCTCGTCACGGCCGTGCCACCTCCGCTGCGGATATGGACAGTGCCGCCGACAACGTCGCTGCCACT
GCCACCAGAAATGTCCACGTCTCCACCCGTCTTCCCGGTACCACTGGTCAACAGAATGCGACCACCCGTGCCAATGTTGCTGATGCTTGCGCCGGCATCC
ACGCTCACGTCGCCACCAACATCGTCGTCGCCGCTTCCGACGCCTACGATAATCGAACCACCTTTCCCGCTGGTTGCATTCGAAGACGACACCAGCACGC
TACCAGAGACTCCGTTGCTTGACTGACCACTTGACAGCGTCACATTCCCGCTGATCTGAGACGCAGATGAATTGGCCGAAGCAATATAGACATTCCCGGA
CGGACCTTCACTTCCCGGTCCACTCGACACACGAATACTGCCACCTACCGAGCTGTCACCTGAACCACCTGTCAGCAAGATGTCGCCTCCAACCCCGTTT
CCGGTTCCACCCGAAAGGGAAATAGATCCGCCAGCGAGAGTACCATCACCGGATCGAATTGCTACTAAGCTCCCAAAATCGGCCGTGCTAGATCCAACGC
TCAGCCCAATCGATCCGCTTTGACCACTTGTGGCGTTTGAGGTTGAAAACGACAATCCACCAGATCCAGCGTTTTCCGAACCGCCTGTGGACAGCAGTAT
CGACCCGCTAGATTTATCTCCAAATCCCGATCCAGTGGCAATAGTCACATCACCGCTCACCGCAGATGTACTAACACCGCTTCCAATTACCACGTTTCCG
CCGGCAACATCGCCTCCAGTCCCACCTGACATCAAGATATCACCGCCAGAAGCCTTTCCAGATCCTCCGCGGATGGTAACTGATCCGCCGGTGCCGTCAG
CGTCTGTGCTGCTGCCGCTCGTGATGTCCACAAAGCCGGTTTCTACCAGTTCACCAGAGCCAACAGCAAAGGTGAATTGACCCACTTTGGCCACTAGTAG
AGTCTGAAGTCAAAGTGAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCAGACGACAACGTCAAGTGCCACTCGTCTGGCTCGGACCAGATGCACCGGTAGCAATCACCACGTCTCCGCTCGTTGCGTCACCGCCCTCG
CCACTCGACACACGAATACTGCCACCGCGGACGGTGTTGCCACTCCCACCGATCAAATCAATGTCGCCACCAGTCTCTGTACCCGTGCCGCCGGATAACC
GAACCACGCCGCCAACGCCGCTGTCGTGGGTACTCTTTCCACTACCGATGTTAACAGATCCACCGACCGGTGAATCACCAGATCCAACACTGATGGTGAC
AGACCCACCTCGGCCACCTACAGCAGCAGACGACAACATGAACAAACTTCCCGAGTTGCCATTAGTAGACGAGCCAGAAAACACAGCGACCTCGCCGCTC
GCTTCATTTGTTCCCGAGTTGGCGCTAGAGATAATCACTTGTCCACTCTTCGCATCATCGCTACTACCACTGCTGACTCGAATATTTCCACCTTCGGTAC
TCGATCCTTCGCCTGCCAAAATTGTCACATCCCCGCCGAGTTTCGTGCCATCCCCACCGGCTATTGCGACGGAGCCTCCAACACCACCGGTATCTGTACT
GCCACCGCCTGATATTGAGACTCTGCCTCCTTCAGGTGCATCCCCAGTGCCGACGTTGATGGTCACATGTCCGCCGTGTCCGCTTGTTGCGTTCGAAGTA
AAGATAGTCACAGAACCAGAGGAACCGCTACTGGACTCTCCTGAGGACACCTGTATTTCTCCTGTGGAACTGGACGTCGATGTTACTACTGAGACATCGC
CACTTGTACCTTGCTCCCCGTGTCCACTTGAAATCGTTATACTGCCGCCGAGTAAATTGGAGCTGTTACCTCCTACTAGGTCTATGGAACCTCCACTTTG
AGAGCCAGTACCTCCGAGTACAGAAACAGTACCACCAAACCCGAGTTCGTTGACAGTACTTCCAGCGCGCAATGTAATTCCACCGCTTTCGCGAGTAGTA
CCGGTACCAACTGCAAGAGTTATAGATCCGCCCTGTCCACCAGTTGCATTTGAAGTTCGCATGTCCATCACACCGGAACTGCCTTCAGTAGATACACCCG
TCGAAAAGCTCATTGGTCCACTGTTTTGCTTTGAACCTGATGACGCAGTTAAGAACTTGATCTCTCCACTAGCTGCTTCAGCCCCGCTCCCACTGGCAAT
GATGACACGACCACCAGCAACGTTCCCTGTACCGGCCTCAAGAGAAACATCACCGCCTGCCATTGTTCCAGAACCAGCAGTCATCGAGATAATCCCGCCC
ACTCCATTTGGGTCAGAACTATTGGCTCCACTGAAGTGAAGCTCCCCACTTGCTTGAGAGTCGCCAGAACCAACGCTGATGTCGATTGAGCCACCCTTAC
CGGACGAAGCATCAGATGTCGAGATCAAAATATGACCCGAATCCCCTCCACTTGATACTCCAGACGAAAACGTAAGCGAGCCACTCGTTTTCATGAGTCC
AGACGCCGCCGATCCGATCAGTATATCCCCACTTCTAGCAGTATCACCTGTACCACTTTCAACTTGGACATCACCACCTTTAAATGTGTCGCCTTGTCCA
CCACATAGTATAATTTCACCTCCAGCTTTCGATCCAGCGCCACCTTGAAGCGACACTACACCTCCGGTTCCATTAATGTTCATTGCCAATCCAGCATTAA
TGCTGGCTGTACCGCCAGACGTATCGTCACCAAGTCCCACACTTAGAGAAATAGATCCGCCTTGACCTTTGCTGGCATCGGACGTCACAATGCTAACATT
ACCAGACGAGCCTCCGTTGGACATACCTGATGATATCTTCACACTCCCGCTTGTCTGATCAGTACCAGATTCTGCAGACGAGATAGAAATGCCCCCGCTA
GTAGCAGCAGAACCAGATCCACTGAGAACGGTAATATTGCCACCTTTTCCTTGGTCACCGATGCCTCCATACAAATCCACATTGCCTCCATCATTTGTTC
CACGACCACTGGACAATCGAATTGAGCCGCCAACACCGCCTGCGACAGCACTATTTCCAGCTGTGAGCTCAATCGCACCTCCTTCCGGAACTTTTGCAGA
GCCAACCATAATCTCAATTAGTCCTCCTTTTCCAGATGTTGCATCGGATGTGCGAATATCAATGCTTCCAGAATCTCCCATGGTAGATTTCCCAGTCCAA
ACTTGAATATTCCCACTAGATTGTAAATATCCGGAGTCTGCTGTTGATATTGCTACGTCACCACTTTTCACAACAGGGCCGCTCCCACTGGTGAGAAGGA
CGTCTCCTCCAACTTGACCAGTTCCGTCGCCTCCAGAGATCTCAACATTGCCGCCGGATACTCCGGTAGCACCATTGATTGCAATGTCACCACCAACACC
AGCCGTATTAGTCGAGTCACCGCCGCGTATGTTCACTGCACCACCAACGTCGTCATCACCGGGGCCGACTGTCAATACGATTGATCCCCCTTGGCCTTTC
TGAGTTGATGCCGTTTTTATTAAAATTGAGCCGGAGTTTTCGTTGCTTGAATTTCCTGACATAATTGAGATTGAGCCGCTTCTTTGACCTTCCCCAGATT
CTGCAGACAAAATCGACAGATCGCCGCTGGCTGCACTATCTCCACCGCCGCTTGTGACGATAACGCTCCCACCATGTCCACTACTTGAAGTACCACCATG
CAGCAACAGATCACCTCCTTTATTTGAGCCTGAACCACCAACAATCGACACAGCGCCTCCTACTCCATTCGTGTGCGTACTCGATCCAGCAGCTATGCTC
ATATTACCACCATCACGAACGTCTCCGGAACCGACGCGTACAGCGATAACTCCACCTTGTCCACTTGTAGCAGCAGCTGTAGCAATTGTAATATTGCCTG
AATCGCCTCGATTTGCAACTCCAGTTGACAAAAACACATTCCCGCTGGCTTGAGTACGACCTGATGAAGCCGTAGAAATTGCAATTTCTCCACTAGATCT
GTCGCTGTTGCCACTAGAAATGCCAACATTCCCTCCTTGAGCCTCAGTTCCTTCACCTGCCGATAAAGTAACATCGCCGCCGTAGCTTGCACCAGTGCCA
CTAACAAATGAAATGCTTCCTCCTTTTCCACTTGGATGCGTGCTTTGGCCTCCATCTATGTAGATAGAGCCCGCCTTGTCATCGTCTCCCGATCCAGCGC
TCAATGCGATTGATCCGCTTTTCCCGCCTTCAGCATTTGACGTCAAAATGGATGCATCTCCGGAATCTCCTCCAAATGCAGCTCCTGTTGAAACCGAAAA
TGAACCACTTGTTTGCTTTGCGCGGGAGATAGCAGTTGCAATTGAAATATCACCACTAGATGCGGTTGGCCCATATCCACTCAGAACTCGAACATTACCG
CCCTGTGTGTCTTTGGCTGCGCCACCGATGACTTCAACATCGCCTCCAAGATGCGTTCCATCACCTCCACTTAGAACAACGCTTCCGCCGACGCCATCTG
CGTGAGTGCTATTCCCTGCAGTAAATGCAACTCTGCCTCCATTCGCAGTATCACCAGTTCCCACATGAATGTTGATTGAGCCAGCTCTTCCGTTGGTTGC
AACTGACGTCAACATGTTGATTACACCAGAATTTCCGTTACTTGAGTCTCCAGAGGATAACGTCAACGATCCGCTCGCACTTGAAGAACCAGAGGAAGCG
CTGCCAATGACCACATCTCCACTCAATCCATGATCACCAGTGCCACTTGTAACATGAACTGCACCTCCTTGCAAACCATTGCCGATCCCACCGGATATAT
CAACGTCCTCACCAGCATCTGGACTTGATCCCCCGGACAACGAAACACTACCACCAGTAGCTTTTGCAAAAGTAGCAGCACCGGCAGCAATGTTGATCTT
GCCTCCATCACCAGCACCACTGGAACCGACAGAAAGCGATATAGAACCACCTGCGCTTTGTTCAGATTGTAGCGTACCAAGTGACAAATTACCAGATTTT
CCCGCAATCGCAGACCCAGTATTGATCCGAATTGTACCAGATTCGCCTGCCTTGGCATTACCGGACTCAATGTTGACATCACCTGACATGCCGTTACTCC
CCTCACCTGTTTGCAGTTGAAGGGTCCCAGAGGTTGCAGCGTCTGCGGCAACGCCAGACGAGCTCAATCGAATGCCTCCAGAGGAAGAGTGAGCGCTCGT
TCCTGAGGTTAGAGATATCTCGCCACCAGGAAGATACACCGAGTCTCCTGAGCGGATGGTAACATCGGAGCCACGCTTGTTGTTTTGGCTACCTGCAGTC
AACGCCACTTGCTTTGCTGATTCGATTCGGACGTCATCAACTTCAGAAGAAATTGTGGTCGTCTGACCCAAAAGCTGGACTCCGACATGATCAACTTTAA
TTCTACCACTCGAAACTCCACTTTCAACGGTCGAGAAGATCAAATCGGTCGTATTGACGTCACCCACTTTCGAAGCAACCACATCGATACTGGCACCAGC
TTGAACCTCGGCGTTGCCTTTGACGTGCAGCAAAATCCCGGTACCGATGCCATCAATTTGGACCGGCAGATCATCATATGTTGGGCCCGCGTAAGGGCGA
TCGATAAAGAACTGAGTCGAGCTGATCGGTCGTTTCGGGTCAATCAAATACGACGCCCCCGCAAGTCGCACGAACTGACTGGCACTGAGTTCAGCCGATA
AATCGACCAATGTCGTCACTGTATTGCTGCCATGCACAACAGAGACATTGCCAGGTAGCACGAGAGCTTGCGCAGTGCTTGCATCTGCGAAATGTCGGAT
CTGGAATGATCGATGAGAAGTGC