Description :
From Genome Similarity Track
Location :
Scaffold_30:62193- 67022
Sequence
4829 bases(100 bases per row)
TCACCGGAGGAAGTCTCGTACTGGTGATAAGGTCTAAGGTGACCGACGAGAACGTAGGATGCGTGCGCATCTTACGTGGCAGTCAAATCTGGATGCGTTG
CCTATGCGGCGCAGCATACGAAATGGACCGATGAACTTGGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTCGAGGTAAGTTTACCGTAGATA
GTAGGACTAGGTCACCTTCATTGAATGAAAGAACATTTGCCCTTCCATTCTTGTCTGCGTTTTTCGTTTGTCAGTCCACTGCTTCAGCAATGGAATCTTG
CACGAAACGGACAACCGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTTGGCTGTAGTGCGCTTGGAGCTCACTGTGGCAAGATCAGTG
ACCTGGGTAGTAAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGACATCGGCGTCATACGTAGTGACCTCGTGGTCAGTAG
GTGCTGAGTGAGAGCCGACTTGGCGTTCGCTCGAATGATTCCCTCCCCCCCTCAAATTAGAGATACGCTCTAAGAAGGTAGGTAGGCGTGGGCTCAAGAC
CGCGGTTTGCACGTTCTGTCTGACCATCTGTTTCAGGATGGTCAGAGGTAGACATCTGAAGGCGCGTTCCAAGTGTTCTGAACACGGATCGCCCGAATTC
AGCAGTGAACCGTGGGTCTCGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGCACATGCCGATGCATTG
ACAGATTCAGGTACAGCGACCAGGTGTGCCATTTTACTGAATCTATCAACAAACACAAGAATACCGGTATTATTGTGTGGGTCTGCGGGGAATCCAAAGA
CAGTGTCCATTGAGACAGATTCCCAGCATTCTGCCGGAATAGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGACCAGACTTCACTCGTTGACATACTTC
GCATGCGCGGACGTTCTTACGCACGAACTGATACTGGTGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATATTTTTTCTCTCGACCACGATGCCCACCA
GTAGGTGCATCGTGGTACTCATACATGATACGCAGCCGCAGGTTACAATGGTCTGATACGACGACACGAGGTGTGTCGCCGGCAACGGCTGTATACTTCA
GTAATCCATTGTGAACTGTATATCTATACGTGGAGGATCGATATACTGGAGGCAACCTTTTAAGGGATTGACGGGATGGTTGCAATAGATTTTCCATCAA
ACGCACCATCGACGGATCTTACGCCTTGCGTATGTCTTCTAGTAAGGTTGACGACGGGACACTCGACGTCAACACCGCGACAGTGGTCGGAACAGTGTCG
GGTTGCGCAGCCGGTTCGAAATTGGGCCGGCGCGACAGAGCATCAGCGACGACATTCAGTCGTCCTGGCTTATATTCCACGGAGAAGTTATACTCCGCGA
AGAACGACAACCATCTCGCCATTCGTTGCGAGAGGTGTGGGCTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTATGCGATGAAGGGTCTATCACC
TAGTAGATAGAACCTGAATTTTGCCAAAGCATACTTCATGGCAAGGAGTTCCTTGTCATGGACTGGGTAGTTACGTTCAGCTGGTTGCAGCTGACGTGAC
TGATAGCAGACGACACGCTCAGCGCCGTCTGTGTCATACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGT
CTTGGTCTGCAATCGCCAAAACTGGCGAGCGTATCAAGCTTTGCCTGATACCTTCGAAGGAGCGCTGACAATCAGCACTCCATGCCCACTTCTAATTCTT
TTTCAATAAACGAGAGAGATGAACAGTCATCTTGGTGTAATTGTGCGAGCATTTGTGCAAATACGCCGCTAGACTAAGGAAATTTCGAAGTCCTTTTATG
TCGGTAGGCACCGGCCAGTCAGTGATCCTTGATCTTTTCCGGATAGGGCCAGACACCGTGCTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCA
GCAAATATACACTTCTTGAGGTTGGCATACAACTTGTGCTCACGCATCAGTGTAAGAACCTTTCGGACGTGGAGTCAGTGGACTTCCAAATCCGTCTGTC
CATCCATAGCCTAGCTATGGACGAACACGTCATCGAAATAGCTGGGTGCGAACTCTCGCACTGATCTCAACACATTCGTAATACATCTGTTGAACGTAGC
AGGGGCATTACTCAGCCCTTGTGGCATTACTAACGACTCCCAAAGAATACCTCTTGGGGTGCTTAATGCTGTGTAAGGAATGTCCCTATCACGTGTAAGG
ATCTGATAGAACCCGTCCATCAGATCCATCGGTGAAAAGATGGTACTCCTTGCCATACCATCTATAATGACATTCTTTCTTGGTATCGGTGTTTGAGTCG
GTACAGTGGCAGCATTCAACTTGTTGAAGGCATGTACTATCCGCCATCCTCCTGTGGCCTTTCGAACGCAGAAGGTCGGAGAGCTATGTGGGGAATTAGA
TCCCCTCACGTGGCCCGCTGCCAAGGGATCGGCAAAGAATTTTCAATCGCTAGTACTTGTTCACAAGGCAATGGCCATTGCTTCATGACACAGTACTTTG
AACCTGGTTTCAGGTCGATCTCATGACGAGTACCCTTATCCTTGGGTAACTCGCACGGCACTGTTTCTGAGAACACATGTCTCAATTCCGTCAAATCATC
GTAGAGAGGATTTGTCTTGAGAGATTCCCACGAATGGGATGTGTATCGCTCAATCCCAGTCTTCTCATCAAGGACACTCTCGTCCATTGACGAGCTGCTG
ATAATCCTTTCGTTCTCAGCGAATACCATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGAATTTGCCACTAC
GCAGATCACGCAGGAACCTTTTCTGTTCGAGCGTGGGCAATTGAATGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAGTTGGTAAGTGCCTATT
CTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTATCTCCTGGGAACTTATTTCCACTGTTGGGTGGGGTCTTATTCCCTCACTAGCCTCTTGGG
CTAAATCATCATCTGACACGAGTGGAATTGCTCCCTCGTTATCTTCTGGCGGTGGTTGCGCTACCGCCAGAAGGTCTTCTACGTGCGATTCTCCCATCGC
ACTAAGATCATCGTATTGCCAATCATTGACAATCGGTTCATTTTCACTTGGGTGTTGTCCGTTTGGAGGACACCCATGCCTCAGTCCACTCGACTCATTC
GGGTGGCGGGCCTTCGGCTAGACCTGCATCTCAATGCAGTCGCCGGAATATGGCTTCTCGTAGTACACCTACATGTCATCAGATGGCCATCTGATGAACA
AGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGCTCGTGCCGTCTGAGCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAG
TCTATTATGATGAAGTCATCATTTTATTGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGTGCTAGTCGCGAGGC
GCACCGTCATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTTTTATCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACAATC
GACTAGGGCTCGAAGCGAAATGGTTTGTGTCACTTCGAGTATCAAGGTACTGAGGGAAACCTCATTACCAGAAGCAGCAACACACAATGACTGAGTTTTG
GGAGCAACTTTCGTCAAGAGGCCTGCAAACCCACTTGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCTGTT
ACGTTGTTGCGAAAACGCAACAACGTCGAACCCACGCCTTGGACCTCACTTGGCCGCTAGGCGGTTACTGTTTCCTGCGGTACGTGGTACCGCGTTCGGG
GCACTGCATTAATATGCATAATGCCCTGTCTTCTGACATCTATTGCATTTTTGTAATTTCTTGTAGTTGTTAACACGAGAGCTCTCGCCCCCACGCGTGA
CAGAGGTCCATTGGTTATGGCCCCCCTTTTTTCTGTCGTCTCAACGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACACGGAAGTCCTCCTGTT
CCGCAACCCTTATCGCCTCTTCCAGGGTGTTGAACTCCAACAGGAACAGGTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAAAGTTATCAA
CTCTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAAATGACGTATGTACTGATGTACGAGTGTGCGTCAAGTTTACCTTGTTTGATTCTTAGGA
GTTTAGAGCGAGCCCTGAACTCCGCTCGCGGAGGCTCAAAAGTTTGCCTAAGCAGGGACTTGAAGACTTCCAACGACCCAAAGACATATGGGTCGTGTAA
CTTAAGGTCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGCGCAAATGCGATCTGCATTTCCTCATCGACGATATAACGAGCCTTTATGGCA
TCGTCTAGTTCCACGAACCATCTCAATAGAGAGTCTTCATCGGCTCCTTTGTATTTTGAGATGTCAATCTTTAGAGTCTCAGGTCGACGTGTATACGTCG
ACCCGGTAGCAGTGGCCTGCTGCTGTTCC