Description :
From Genome Similarity Track
Location :
Scaffold_74:6218- 21310
Transcript NameFunction/comments
Phyci_232868Hypothetical protein
Phyci_94704Hypothetical protein
Phyci_23270114 kDa zinc-binding protein
Phyci_232951conserved hypothetical protein
Phyci_232840kinesinassociated protein putative
Phyci_525834Hypothetical protein
Phyci_525837hypothetical protein

Sequence
15092 bases(100 bases per row)
AAAAAAATCGCCGAGCAGAAGTTCTTCATGAACTCGAGGAGTGCGGCGCTGGCGCAGCAGCTTGTGCCCTCCACGTACGTGCAGCAGGGGCTGGATGCAG
TCCGCTCGCGTGAGAAGCTGGTGACATCTCTGCTGGCGCAGCGCCGCCTCCCCGACGAAGGCTGGGACGACGCCAGCGTGGAGCTGCTGCTGCACACGCT
CTCGGCCATGGACAGCAACAACTTCCGCGGCAGCGCAGGCGCCGGCGAGCGCGAGGCGCGCGTTTTCTCTCCGCTGGTGGCGCGACGCCACTTCTACTTG
GCGCACGGGGTGGGCAGGTCGGGCGACGTGGCGGCGGTGCAACCCAAAGCGGCGGGGTCGTCGCTCCTCGTGCAGGTGGCCAACGCTCTGGCCAAGGATG
TGCTGCGGCTCGCTGGGATGCGCGCGGTGCAAGCGGCGCTGGTGCTGCCTGTGGCCACGGGCATGTCATTGACACTCGTGCTGCTGCAGCTCAAGGAGTC
AAGGCCCCACGCGCGCTACGTCATCTGGCCGCGGATCGACCAGAAGTCCTGCTTCAAGTCCATCTTGGCGGCTGGACTGACGCCGCTGGTGCTGGCGAAC
GTTCTGGTAGAGGGAGAAGGCGGCACGCCCGGTGATTTCCTCAAAACGGACCTGGCAGGCATGGCAGCTCTGATGGATAAGTACGGGAGCGACAGCGTGC
TGGCTGTGATGAGTACTACGAGCTGCTTTGCACCGCGGGCGTATGACAGCGTGGAGGAGATCGCCAAGCTTTGTCAGGACCGAAAAATCGGTAAGAGCGA
GTCGAATGGATTGTACGCAGGATGGTGACTGATGAAAGAGAGTTTGCTGTGGTGTGTCTTGCCAAAGCGCACGTGATCAACAACGCGTATGGCGTGCAGG
CATCTAAATGCGTGCACCAAGTGGAGCTAGCGATGCGCACTGGTCGAGTGGATGCTGTGGTGCAGAGTCTCGACAAGAATTTCATGGTCCCTGTAGGCGG
GGCAATCGTGTGCTCGGCATCCCCGGAGGTTGTCGACCGCGTGGCAAAGTTTTATCCTGGACGAGCTAGCGCTACACCAACGCTCGACTTCTTCATCACC
ATGCTCCAGATGGTTAGTTCGGCACCCATATGAATTAAGCTTCGCTGGTTATTGACGCCGACTCATCTGTATATCAGGGGAAGCGTGGATACCAACGGCT
ACTGCAAGAACGCAAATACCTCGCAGTTTACATGCGCGAACAGCTTGAAGCCCTCGCAGCAGACGAAGGGGAACGCGTGCTGCACGTCTCGGATAATGAG
GTAACAGTGACACGCTATTTGAGGCGGTTGCAAACTCTGCTGTCTTTTATCCACATCTAATACGGAGTGCTGATTTGTATACACAGGTCTCTTTCGCGAT
GACACTAGGCACGTTTTGTTCAAGTATGACGGACCTGCAAGAGAAATCACGACAACTTACTATGCTGGGAGCTATGCTGTTTTCACGAGGAGTATCCGGG
GCACGGTGAGTTCGAAGCCAAGCTAAGTGGGTGCTTGTTCCCAGCCATTTTGACAGTTGCGTGCGTGCTGTCACAGTGTGGTGTCATGTCTAGACCGCAA
AACGATCGCAGGGCATGAATTTAGTGCCTTTGGAGCGCACCACGACGCCTTTCCGGTAGCTTACGTAACTTTTGCGTGCGCACTGGGCATGCAGCCTGGC
GAGGTAGATTTGCTCGTCACGAAGCTGCAAAAGACTATTCGCGAGTGGCGCATGAAGCAGAAAAGAACAGAAATCTCTGCGGCACCAACCTCATCCGAAT
CCGAACTAGAGCAGGAATCAGCAAAGGATTTCAAGAATACTCGTCTATAAATCTGTTTCCTGACGTGCTATCTTCTCCTGTGGCCTGGTTCCCAGACAAC
ACACGGTTTAGTGCTTCTTGCCGCCACTCTTCGACTTCTTGTTCTTCTTCTTACTCGCAGGTGGCGATCCGGCTTCTTGCTCAGCGTCGCCCTTGAACTC
AAGCTCTCCGAGGAGCTCTTTGGCAATGGCATCAGCTGCAGCAGCGGCATCGACTTCCCGACGGCCCTTAGCGCCCTCCACAGCCTTTTCCGTGAATTTG
GCCATGAACTTCGCCGACTCAACCACGCGGGGGTCCTCATCGCCATACGCCTCCTTGTACAGTGAGTACACCTTCTTTTCGTACGCAAGCGCCTCGCGGT
AGCCACCAGCCAATCCACATGCCAAAGCCATTTGGCGCAGCGTATTTGCCGCCTGATTGCGATCAAACTCGCCGCGACGGAGAGACTCGCGGTGGCACAT
TAGCGCCAGCGTAATTTGCCCCACGTCCTGGCACATCATGCCCATCTTGAAGTAGAGCGAGCTGATCTCAGGGAAGTGAGGGCCGCAGCACAATTCAAGC
AGATAAATGGCACGGCGAATGTGCGGAACGGCCAGTTCCGTCTGGGCATTGGCGTGCAGGAACAACGCCAAATTCGCGTGCGCGAAGGCCGTGTCGTGGT
AGTCGATGCCTTGGAGCTGTGTGTACAGAGCCAACGCTCGCTGTTGTTGGACAATAGCACCGGCAACGTCACCAGCGTGGTACAGCACAGTAGCAAGGGA
CGAGCTGCATAGTGCTGCATCCTCATGGGCTGCCCCACACACCTGGAAAAGCAGAGACGACGCCTCCTGGAGGAACTCGTACGAGCTCGAAAGCGCGCCC
TGGCTCAAGTGCACACGACCACGCTCAAGGAGCTGCTTGGCCTGCGTCAACGGATGCGCAGGTAAAGAGCTCTTGACAACAGGCACGACACCAGTGATGT
CATCGAGGGTGATCGGTGCGGCGCATGACGACGAAAATTCGTAGTTACGGCTCACCACACGCAGACCCAGACGCTGGCACAGGCGTCGCAGGAGGACTGG
CTTTTGCACGCGACCAAGCGAGATAGCGTTTTCGCTCTGCACCACTTCGCGGCCAGGACCCCAAAGAGACAACTCGTAATCGAAGCGGGCTCTAATCTCC
TTGTCAATGCGCGCCCACAGCGATTTCACATTCAAGGAGGCCGTCGTAATCGCAATAGCGTCGCTACCATTGGTATCTGCATCATCATCACCCTTCTCGA
CAGCAGCCGAGGTTGATCCGAGAATGCTATTCAAGAGCTTCACGATAGCTGACCCCGGGGCAGCACGAATCGAGTCGTTGGAGTTTAAGACATCCGCCAG
AATGTGCTTGGCTGCGCGCGAGATCATCTCCACTTCGAGCATCTCCAGCAAGTACTTGGAGATACCGTTAATGGCCTCCAGTTTCTTGGCAAGAGACGCC
AGACGGCCCAGGTAACGCATGTTGATACCGCACGAGTGCATCAGCTCAGTGAGTGCGTAGCCGTCAGCGGGAGCAATGGCACCACGACGGACGTCCGCCA
CAAAAGCGGGAACAACAATTTTCTGGAGGTACTCAGCGGCATCCTTTGCGGCAGCTTCGTCAGCCTCGATCTGCGCTGCATCGGTTGAAGCGGGGTAATC
CATAAAGACATTGGGGTTCAACACCACCGAAGGAACCTCTTCCTCCTCCTCTTCCAGTTCGCCCTTGTCGGTTTCCTTCTTCTCAGTCGCGTTCTTTTCA
TCCCCAGCCTCAGAAGTCTCACCCTCCTTCTTGTCCTTTTGGGCTTCCGCTTCCTTAGCCTCCTTTGCTGCAATACGAGCCTCGCGGTTCGCGCGACGGG
CCTGGTTCTGCTTCCACAACGAGTATAGCTGGACCAGTTCCGGGCGCAACAGTGCCACATAACCTTCATCGTCACGAGTGAAGCACAGCCCGTCGTCCTC
AGGTGCAGAAGCCTTCTCCTCTGTGTTCTTTTGCGCAGTCTCACGGTTCTTGTAAAAAGTCCAGTCCTTCGGCGTAATACGGACGAGATCCAGGACGTAC
AGGCGACCATCGGAGCCCTGAATGCCCTTAGCCTCAATGGCACCACAGATAGTGGCCACTTCTGTGCTTGCTTCGCCACCGCTCACAGGTGGGCCACCAA
GACTTTCCTGCTCCTTCTCGGCAGCCAGCTCTTCTTCACTCTTACCAAGTGGCTTGATGCTGCGCTCCGCAATGTGCAGCTTCTCACCAGCCTTCAGCAT
AAGCTTATGCATGGAGCTGTTAGCAGCAATCGTCTTACCGTGATCCACAGACCCGTACACAAGCTTGGAGGACGCATCTCCCATAAGAATGCCTGGGATA
AGGCTCTGGGCAATGACACGAACACCAAGGTAATCCACCACCGTCGTAGCCAGCGTATGCAGGTCACACACATCCACTTCATTGAATGCCTTCACGCCCT
GCAGGTCGCGGTTGGCAGCTGAGTACGCATTCTCCTCGCCGCCAGCATCCGCAGAAGACTTACCGTCAATAGACACCGAGAAGAAGATGTTGTTGAAAAC
GTACACGTGCGCACTCTTGTCGTCCATAGGGTTGATAGGAGGAATGTTTCCCTCAACGATGGCCACCGCGCCTTGCGTCGCAGCCTCCACAAACTCCGTC
ACGATCTTGTACATGACCCGAGCGCGAACAATCTCCTCGTTGAGCGATTTCGTCGGCAATTCACGGCAGCACTGGTACTCCTCGTTCCAGTCACGCAGCA
CGCCGCGCTCATCCATGCCGAAAGATGAACAGAGCTCGTCTTCCGCACGATTAAGGTCGTACGTGTGCTCCTCAGTCGCTGCAGCAACAGGGGTGTTCCA
AGGGAGCTTACCACCCAGGCTGGAGCCAGCAGCCACCATCCACTCAATCGAGGAAGGTCCCTCCTTAGCCAACGACGCAGCCTTGGCGAGGAGAGCAGCA
TACGACTCACGGAACTTGGGCGACACGGTGCTCATCACATTCAGCAGCAGGTGCGAGTGCGCAGCGGCGGTCTTGTGCGGGCGCGGGTCGAACTTGGATG
CGGTCGAGCGGTTCACGAAGAAGCCATTGACGTGCGCCGTGATGTGGTACCGCGTGTTGTCGCCTGCGACCACCACCTCCAGGTAGAGCAGGTCGCCCGC
CAGCTTGCGGGGTCCCGGGGGCGGGTTGTAGCCCGAGAAGACGATGCTCTTGACGCAGGCAGGGAGCTTGGCATCCGgctgctgctgctgttcctgctcc
ttctgctggctggcgtcgttctgctgcttctgcttgtttttcttccccttcttgctcttcttctGGTCCTTGCCCTTGGCGGGTGTCTGCTCCGCCTGCT
CTGACTCCTCCTGCGCAGCTGGGGCAGCGCCAGGGAAGTTGTAGAACTCAGCCAGCTCGGGCTTGACCGGCACCTCGACGCCCTCGAGCTTGTGGTGGAT
CTCACGCAGACGCTTGAGCTGCTGCTCGGAGATCTCCTTGAGCTTCTTCTCGTCCATCTCCTCGCCCTCGGCCGGCTCCTCGACCTTGCTGGCGTCGGCG
GCGGCTTCGGGCTGCGCCTCGGGCTCCGTGGTGGCCTGCGGGATGGGCGGGTTGCTCAGCACGTCGCGGAAGCGACGCACGTGGGCGCGCACCTTGCGCG
CGTCGTACTTGTCCAGCACCATGCGCAGCGTGGCGCCGTCCGCCACGTCCTCGTACTCGGCGAGCTCCACGAAGTCGTTGAGCGGCCGCCAGGCGCCGTC
CGCGAGGCTCTGGGCCTCCAGGTGGTAGCACGTGAAGCAGGCGAGCGCCGGGAACTCGGCGATGAGCTGGCGCAGAGACACGACCGTGTCCGACGGACTC
ACGCTCTCGAGCCGCACGGGCTGCGCGCCCTTGGCGGCGGGGGGCGCCACCAGCACGCTGAAGGGCTGCTCCTCCGCCGCCACGGCCTGCTCTTCCGGCT
GCTGCTGCGCCGGCTCGACGGTGTCGCTGCTGCCCATGGGAACTCGGTCTTGCGCTGCGGGGCTCTGGTTGCGATCTGAGTGAGGCCAAGTGCGTTGCAA
CGTGTGGTGCGCGAGCGCAAGAGGTCTGCGGCTGCCGGACCAGCACGAGCGGGAAAAGAGCAGGGCTGTCTGGGATACTGAGAACGCCGCAAGTACGATA
TTTGTATACTACGTGCTGGTCCGATAGCGCTTGTGGATGCCCGTCAAACCCGAGCCCGTCGGATGGGGAGAGCGGGCTGGACAGGGGATAGACTCCCACA
GCATTGAAGTTTCATCTGTTCTGTTGTTTAGCCAGGCATTTCTATATTTGCTGCAATGTATCCAATCGGTAAATACAGGGTATGTGAGGTGATAGGATTT
ACGCACCGGAATAACACGCGCCGAGCTCCGAGCCCGCGGCAGCTTCGACGTGGGTCTAATGGCGCTGCACACGCCACCTGCACAGCGCTTGGCGCCTGCA
CAGCGCTCGGCGCCTTAAGCATATGCCGTGGTGCGAGGCCTATGAATTAGCGCAGATTGCGCGCATTCGGCTGGCCTGCTTTTGCAGCCATTTTTGATGG
ATACCGTGGTGTGCGCTACACAACGCATTGAATTGATAGGCATGCTCATCGGAGCTCTTCGCCGCAGCCTGGCGCCCTCACGACCCTCGCTGCAGCTGCG
CCGCCCGCTTGCCCCCTTCGCGCGCCGCGCCATGAGCTCCGACGAACGCGCCAAGGCCGACGCCGCGGCTGCCTCGGGTGCTGCCGCCGCCGTCGGCGAA
ACAATCTTCGACAAGATCATCAACCGGCAGATCCCCGCCAAGATCGCGTACGAGGACGAGCAGTGCCTGGCCTTCCACGACGTGAACCCGCAGGCGCCCG
TGCACATTCTCGTCATCCCCAAGCAGCGCGACGGTCTCACGCAGCTCGCGCACGCCGAGGAGCGCCACGAGGCCATTCTGGGTCACCTGCTCTACGCCGC
CAAGCTGGTCGCCAAGCAGGAGAGCCTGGACAAGGGCTTCCGCATCGTCATCAACGACGGAGAGGACGGCTGCCAGTCCGTCTTTCACCTGCATCTGCAC
ATTCTCGGCGGACGCAAACTGGGCTGGCCTCCCGGATAAAGGGGCGGGTACGCCATGGCGGCATTGATGCGCTTGAGAGTGTGGAGAAAAACTATCAAGG
CACAACCAGCCGCTCAAATGTGATCGTTTAAGGTAGCAAATGCAAAATACAAAGGATCTACCACTTTATTGAATTATTTTCTGTTGCTGTCCGTAGTGGC
TGTCGGTGTGCTGCTCTGTCGATCTATCCGCGGCCGCTGATCTCCTTGTGGAATTGCTCCAGGAACGTCTCCATGAACGCGTGGCGCTCCTCCGCCAAAC
GCTTTCCGGCGTTCGTCTTCATCATGCCACGGAGCTTGAGCAGTTTCTACATCGTCAGTAAAGATTCGTGAGCTGTGTGATACCAGCGACAGGAAATCAT
CTGCCCTGCGTACCTCGTAAAAGTGGTTGATGGTGGTGTTGGGACGGTTCGGATCCATGTACTGCTCTTTGGTCATGCTTTCAATTGGGGGCACGTCTGG
GTCATACAGCGGGCGCAGCTTGTGGCCTCCGTACGTGAAACAGCGGGCGATTCCAATGGCTCCGATCGCATCCTACACAACAAGTAGTCCATTGCAGCGT
CATGAACGTAAGCACTTCATAGTTTTCACAATACGCTACGAAAACGGCAGCGTACCAATCGGTCAGCATCCTGGACACAACCGTACTCGACAGTGTACGA
TTGCTGCAGCAGACACCACCAGCGTTATTAGTTCGAGTCCATCATCCTACCCAATAGCACAGCAGCGTACCGCCGCTCCGCTGGCTGCGAGCTCCTCCTT
GAACCCCATACTGTCGATGATAGACATAACTCGCTCGATCTTGTCGCTGGACACGCTCTCCGACTGCAAGAACGCCACCGCCCGCTTCGTGGGCTTCTCC
TTGTCGCTCTGGTACTTCCAGTCGTCGATGTCATGCAGCAGTGCCGCCAGGTCCACGATCTCCAGGCTCTCCTCGGGCACTCGCTAGAGAGAACAATCAA
GACATAATCCCCATTAGGCAAAGGAGCAAGAGCCTTCAGCTCGGCTGCCAGCGCGCCCACCTCCTCCTTGGCGAGCGACCGCGCCACCGTCCAGACGCGC
TCGATGTGGCGCCAGTCGTGCGAGGCGTCATTACTCTTGAGCTGCTGCTCCACGAACGCCGCCGTGCGCTGCACCAGTCGGGATGTAGCCATCTTCTCGC
TTTGCACTGGGTCTTGGGCCACCAGATTGCGTTCTGAGGACGTGGATAACGTCAAGTGGCTTGAGTCACCCGCCAAGTCGGACGCGAGTTGCCCTTTGTG
GCGCCAAAACCCATGGCGCTCGCGGATTGGTCGATCCAAATCGCGATTAAGTGCGGCAGCTTCAACTTGAAACCCCTGGCACGCGGGCACTCAGCCGCCA
AAAGGCACAAGCCGCCAGACGCACGCCATGAGCTCCCGCGCGAGCTCCAGCCGCGGCCCGAGCCATGCGGCCGTCGTCAAGAGCGAGCGGCCCCGCAAAA
TCACGGCCAAGGCTGACGAGCTGGACGCATACATGGAGAAGCTCTACGACGACGACGTCGAGTCCAAGCTGGATGGGGCCAAGATGATCCTGCAGCTGGC
CGAGTTCGCCGGGAACATCGAGGCGCTCGTGCAGAACGAGTCGCTCATGGTCCGTTCCGCTGCGTTAAGTGTCGGGTGTGGTTGCTATTGCAGGGGCTGA
CTGTGTCTGCTGGTTGTTGACCTGAGCAGAGTCTGCTGTCGCGCGTGCTGAACGACGACTACAAGAAGAGCTACGACTTTTCGCTCACCATGATGCGCAT
TTTCTGGTGCTTCTCCAACTTCCTGCAGCTACACCCGATCCTGGGCAACTACCGCATTGGGGCCATCACGCTCAAGATTGTCGAGTTCGAACTCAAGCGC
CACCAGCTGCGCCTCGAAGAGGAAAAACTGCTGGAGGCTGCAGCCAACGAGGCTCCAACGGGCGATGCCCAATCGACTGAGGACATTCTGGCGAAGCTAG
ACCGCGAGAAGAAGCGCAACAAGAAGCGCATGAAGAAGCAAGACCAACTCCTGTGAGTCTGTGCTGCGTTGGCTGCTCACGAACCGCTCAGACAGCCGTG
AACTAACTCCTGCTCTTGTTTCTGCAGATACGTCTGCTTCAGCGTACTGCTAAACTTGGCTGAGGACATTCACACTGAGCGTAAGATGGTCAAGCGAAAG
ATTGTGCAATTCCTTGCTAAGGTTCGTATGCTTTGGCAGACGCGAGCATGCGTAGTCGATCTTATTATCGTTTTTGATCTCCTTGTTATGCAGTTACTCG
ATCGCGTGGCACCTGACCTGGTTATTCTAACCATAACGTTTCTCAAGAAGCTGAGTATTTTCGAGGAGAACAAGGACGTGATGGTGGATCTAACAGTTGT
GGAAAAGCTCGTACGCTACCTCAACTGCAACCACGACAAAACCATCCAGACAGCTCTAAAACTATTGTTTAACCTGTCCTTCGACCCAGCTCTGCGCGAA
GTGCTCGTTCGGAATAGCCTTATTCCCAAGCTTGTGGAGTTGCTCAAGAAGCCCCCTTTCCGCGCTTTGTCGCTGCGAATTCTCTACCATCTTAGTATCG
ATGACCGATGCAAGTCGATGTTTACGTACACAGAGGCCATTCCGATCGTCATGCAGTTGGTGATCAATTTTCCTCAAAACATCGTGGCGAAGGAGCTTGC
TGCTCTCGCTGTGAACCTCAGCCACAACGCGCGTAATGCCGAGCTCATGTGCCAGAATCGTGGCCTGGAAGCCCTTGCTACACGGGTATTCCGTACCCGT
GATCCCCTCCTAATGAAAGTTATTCGGAACATCTCACTCTGGTCGTATACACTTCAAGAAGATCTAGTCAGTGACAAGGCGTACAAATATCGCGGTATGT
GGGCCCCTTTTGTTGTGCCGTTCATCGAGTTGTGCCTCAACACGGACAATCACGACTTCTCGATCGAAGTTCTGGCAACACTAGCAAACATGACGCCAAG
CGACCTACCTTCGAAGACATCTTGGGACAGATTGGTGGTGGATCATTCGTTGACCCCTTTCCTCAACAAACTCCTGGTCCCGGGTTTCTCACAAGATGAT
ATGATTCTTGAAGTCGTGCTTTTCGTCAGTGCACTCTCGTTGGAGCCGAAATGCGCTCCTCTTCTGTCATCTTCTCGACTTGTGCGCACATTCCACTCGC
TCTTCCAGGAGAAACAGCACGACAATGAGCTTACCCTGCAGCTGCTTTACGCGTTCTATCGCATGCTGCGACACCCAGAAACGTTTGAAGAAATCCTCTT
TGGTGTGGGCTTCGTGCCAGATCTGCTCCTTGCCGCGGATGCTCCCAATATTGAAGTTCGCCGCATGTGTGATGTCCTCATGGATTTGATTTTGGACCAC
GACCTCAACGATGGTGGAACCATTGGCGACTTCGGGCACCTCATTCGGCAGCGAAGGTTTGAAATTCACAATGCGGAGTACCTCGAGATGATCCATGCTG
AAACACAAAGCGTAGCCTATCGCAAACACCACGGAATGGACGACGGCGGCGGTAAGGGAGACGATGACGATAGCAGCTAAAAACTCAACGAAAAGGCTAC
GCAAACGTCCGGATCCATATTAAACTTTCAAATTATCATACTTCTGCTCCTTCAACTGCTTCATGAACCTTAACCGATTCTCTTCTTTGTCAAGAATCCG
ACGACGCTTTTACGGTCGATACCAAAACGCGGCAACGCCTTCTCCGGCCAGTAAGAGTTGTGCTCACTGTTAATAGATGCTCCTGGTGGGATCAAATACA
TGTTGTACGGACACCCAGGTGAAATGGTCAGGGCAAGAGCGCGCGAGTTATGCTTCCGTTTGTCCGAATAGCGAACTAATTGCCGAACAAACTTCCAGTG
ATCGTACGCCGATTCCAAACAGAAAAATGCCATTGCTGATTCATGGAGATTGCGCACCTCGGTTTCCATTCTTTCCATCCCGACTGTTCCTCGCTGTGTC
ACCACAATACCTCGACCGTCAGGAAATTCGACAGGGGCCATTCCATCGCGAGTACGGCACCAGAATGCATCCACTGGAAACTCGTGGTAGCTGCTAGTAT
CGGAGGCGTCTTGAATCCGAATAAGACATGACCAAGCAACGGAGGTCCGGACCACAGGCATCTCACCATCGATCTCCATCTTCTGGTCGTCGCCATCTAG
CGGCTTTGAATCGAGTCCGCAATCGATCAAGTCGACGAAAAACTGCACGGCGCGCCATTCAGCCAAATGCCGAGCCTCCGCTTCTGTCCCCCAAGTTGCC
CGGCACAAGACATGCCCGTCTACTCGTACAGCACAATGTATACCTGCACCAGTGAGTGCATCTTGAGCACTTCGCCCAAATGAAGGACGAGGTGGATCTT
CCACGGTAGTTGTAATCTAGCGTTGAAAAAGAATACGTACTGATAGTTAGGCAAAACTAACAGTCACTGAGCATGAACAAGTAACGTACACTAGCGATGC
CCGACAATTTCAGGGCCTGGAAGGAATCCACAAGCGAGACGTACGCTAGAGACTTGTTGTCCAAGAAATGCAAAAGCTGGGCCCAGATGGATCGGATTCT
ATTCAGCTTGCCCAACATACCATCCACAGCTGCATTACAGGCATCAGGCTTCGCCACCTTAGATGCCTTGAAACGAATGACATCATTGACATCAACAAGA
ACTTCAAAGGTGCCTTCTCGCAGACGCTCCATTCTAATGTTTGCCGTGACATTCGGCACGATTCTTGTATGCTCAGCTCCGCGATACTTTAGCGACCCTC
TGAGTCGATTAATGCCAGCACACAACTCATCCGTAGGGGTGAATAAGCTTCTGATTGCAGCGCGAAACTTAGCATCATCCGAAGTACCGCTTTCGGATTC
TTCTGGATACCGCTTCTCCATTTCTTCTACGAACGCTGCCTCTTGCTCCACTACGGCAGGTGGTTGAGATGCTGTTTTCACTGCTGACGGATCCCAGTCA
TCATCATCAAACCCTCCATCTGAGTAATCATCATCGTCGTCATCCATTTCATCGTCGCTGCACAAAATGAGGTTGCTTTTCTTTACTTGGGTTGGCGGAG
AGGGGCGTGGCTGGCTCGTCGCAGTAGATCCTGTTGTAGTTGTAGTACTTGTTGGACGGTTAGTGCTCGATTTGGAGCAGGTTGACGCAGGGGGTGGCTT
CAACTTGTTGAGTTCTTCCAGAATGTCGCGCCACCTCTCGTTTGCAGACCGCTTAGCGTCTTTCGCGTTTAAGCAAGCTGTCGAAATCGCGAGCGTACCG
CGAACCAAAATGAAGTACATGTACAGTGGTGGAACAAGCTTTTCCGACGCAGATACCTATAGCCAACGCGCAGCACGTCAGTCACCGGTCTGTTATCAAT
CATCTCTAGGTCAATAAGCACAGGCTTACCTTATCATGATTTTTTGCTTGTGTTTCATTACCTGCCATCAATGTTGTTGGGGTTTGAGCAAGTCGGTCAT
TGTAAGTGACCAGTAACGCCTTCCAGGTACCAATAATTCCATCTAGCGTATTGATCAGAATCGTGGTAGCCTTGTCCTTTGCGATCTCAATGGATGCTCC
TTCTCCGTAGGCTTCGACGACTCCCTCGGATACAGTGAGTACGCAACTCACTAGACCATCATTTCGCTTCGTTGCCGTCCGGGATACCTACATGAAATAA
ACGCAGTCGTTACAGAATGGAATCAGACTAGCCGTCCAACCAAGACATGCAGTTTTAGAGAGCCTACCATGAAAGTCGACGAAAGCGAAATTGTCTCCGA
CTTGACTCTGAGGTCCCACACAATTCCTTTTATCGTGCCAATAACCTTCTCTCGATCGTGGAAGAGAAGCTTAAGCAGCTCCTGGTACACATCCGACTTC
GCCTTTGCAGTCACATCTTCTGAGCGTGGAGGGGAATCTCGTTTAGGATCAGACCCGCTTCGGTCTTCCACAAACAGGTTAGCTGTGTTCGATGCCGACG
TGCTGTCACCTTCCTGTTCAGCGTATCTCCTTTCTGATGATAACGGCGTGTCTAGTTCTCCGTTTGAATACGACAGGCGCGGACGAGGAGCTGCACGCTC
ATCTTCATAGCCTTCCTCTGTGCTCGGCGCATAGTGCCGCTTCCGCAAAATCCCAATAGACCTCAATTCTGCGTTCCTGGAATCTGTGTTTTCAATACTT
CCAGTGCGATCATTCGTGCTATCGATCACGCCGTAGTCGCTCACACTGTCGTAGTTGTCCACGCTGTAGTCACTGGCAGGATCTTGATGAGGCTGAATAA
TTTCAGGCTTAGTTGGTTTAAATTCGTTCTTGATTTGCTCAGCGCGGTCGAGGTTTTGGTTCTCTTCGTACTGGTCGATAAGCTCCATCAGGAATAACAT
GAGCGCATCAACTGCCTCGCTTTTCGTGCCAGGTACCGACGAACCACGCCTACAGACTAGAGGAAATTCTTGGATATGGGCAACCACATCATAAACAACG
TTACCAGGGTCCTCGCAGCGCTTCTCGTATAGCTGTGAAGAAAATAATCAATAATATGCCGTGGAGTCATTTCCCAAGATAAGACAACCAACAAGGAGAA
AGCGAACCTACCCGAACAATCCTTTTGGTAATCAGATAGTTGAAGGTCGCGTCTTTCACTTTTCGGGTGTCGTTAGCCGAACAAAAGCCGAATTGACTCT
TCAAATACGCCAGCATATCACCGTAGAGCCTTCGGTGCTCCATTACTGCTCTTGTCAGCCGCGATAGTGCACCTATAGTAGCTTCTCGGTCAATCGAGGC
AGTGAAATCAAATGACAGATGTCCTAGTCGGACGCGAGCATTGTATTCGGATGGCCCAACCATCTTTAGCTCGCGCCGAAGCTGAGGAAAAACCACAGTT
AGGTACTGCAATACTATTGCACGATTACGATGTTTAAGCAGAAAGCTCACCTTGAGTCCCGCAGCCACATGAAACTCCTTGCTCATGGTCACCAACGATA
CAGATTGGACGGCAGTTGATAGTTCCTGGAGTGTTGACACGATATCAGCATTTGGGCCAACCAAAGCCAACAGGTACGCTCGACCCTCATCCACGCCGTA
GCTTCTGGGCTTGGGGGCGACAGCAGCTTCACTTTGCTGCACTGGTGGAGGCTGCGGAGGAGGTGGAGTAGGAGTAGGAGAAGGAATTGTAGCTACAGCC
GAAAGATTAGCAGTGCTTGCCTGTGCAGGCGAGACATCCATGGCAAAAGTCACTCGTTTCTTCGGTGTAGCACCCGGCGCCCTGGATGCTGAAGATTGTG
AGCCATTCTGACGCAATATGGAAGGCGTGCACGGTTTCACGGCGCTGTTGTAGCTGCCATTTTCGGGTTGCCCTGAACTCATGTCGACCGCCATGTCCTC
CACCGCCTGCGCCAGCTCCTTCTCGCTGGCCTTGACGACCGTGGGGGTCGCCTCCACCTCGTTCTCGCGCGTGATCTCCGCGTACCACTGCCGGAACTTC
GCGGCAAACTGGAACTTGCGGTCCTCCATCACGGACTTCCTCGTCTCGAAGCTCATGATCTTGACGTACATCAGCAGCTTTTTGGCCGAGTGCAGCCGCT
TCACGACCAGTCGGTCCTTCGCGATTATCTGCTCGTAGCGCGTCGAGAGTTGCAGCCGGTGGGCGTCCAGCTCGTCCAGAATGCGGAGGACGCGGCCGGG
CGTGCGGCCGACGCGCGGGTCGTCGCGCACAGCCGCCCCCATGCGCACGAAGCGCAGCACGAGCGTCTTCCGGGCGCCCTTGCTCTGCTCCAGCTTGATG
CTGACCTCCGCCCCCACGGCCGCCACGTCCTTCTGCACCTGCTTCAGCTTGCGCGGGCACACGAGGAAGTCCTCGACGCCCATGCCCACCAGGTAGTCGT
CCGCCTCCACGGTGCAGATGGGGTCCGTGGCCGCGGCCTTGCCCGCCACTTTGTCCACGAACTCCATGGGGAAGCGCGGCGCCTGCTCTGAGCGCTTGTC
CACCTGGAACACGTGCGAGTTCATGATGGCCGTGACGTGCACGCCCAGGTCCGCGAGCGTCAGCCCGTCCAGCGCCGCGCTGGGCAGCGAGTAGCGCACG
TCGTATGCGCGGCCCAGCGACAGCAGCTTCCGCGCGGCCAGAGCCACCTCCACGCGCCACAGACGCACGCTCATATCGAACGCCAGCGCCTT