Description :
From Genome Similarity Track
Location :
scaffold_38:62170- 65603
Sequence
3433 bases(100 bases per row)
ctgtacccgcaatgcggactactGCTGTGGTGTTCGCCCCTGACCAAACCGCTGCAAATGATGAAATACactttaagcgatgggtgcagcggcaccagaa
acttttcctcgctgtcaaatttacagcggagccacacggaagtggacgtgcgcgttgagcgccatcttagatttgagcttgccaaagtcAAGGCGTGCGc
actgtcgccctgcgataCATGGAATCAtctatcacgctcccgcgagctctgtgctttCTCACCAAAGGCCAcatcagctcagggccatggCCTCATggtc
cttcggcttcccgggctactgccgagacgCACGGGGCGCACGGCAAcaacgcgaagcgtcatgatccttctgatcataagcgtccacgacgtctgggtag
tcttgccgaagtagcacctcaaactcccacaagttctcggagttcGGGTATCTCCGCCACTTCATAAGATATTGGGTCAAgccccgtcgacgacgtcgcc
cACGCACAAGGCGTTCAACGTCGTAGTGGACGCcgccattctcgtcgagaagagtcggcggcggacgatgacgacttggtcgatcgccgtccagtgaccc
acgatgctcttcgagcgttggagggcaaagtccgtcgtcattgcCATTTTGACTAGCCTCTCTCCGAGGTAGCCGACCGCTgtggaagacctcgagagtc
tggagcactttgtgcaccaactGCCTCACGCTGAGAATTATCGTGCTTTGTAGgggcggctcctagccgtcgagcaggcaaaTACATCACTTCATGCGAT
AGTGGAGTGCCTTGCGCTGTTGGAACCAGATGCTGGTCTAACTTCTAAGTGGCCGAATGCGTCTGGGCGccaccccggcgccaacgcttccgcgttcact
ttcgccgaatcccggtacggctttagTAAGTACAcacaaaacaccgggtgggtgggcatccttctcggaagtttCAGcctatacgcaaggcctcgcgtgg
ccacgaccttaagaggtccaataaaccgcgGACGgaactttgtcttaaagacagcagaagctgcatgtgtaggaagggttTGGCATTAAATAaaacaggt
ctccgacctcaatgttgtCAGCAATTCTTAttccttttccgtctgcatatttcttctgcatgtcttggctttcagccatcgtatcgcaaacgtgtcgtaa
gacactcaatcTGGTAAACAAAAAGTCTTCGACTTATTTACGCatggtgagagggctgacatcagctatccgctcggctattcctcctcaacaagccctg
agccatgggatggcggtgtcagcggaacgcgaggattaagAAGCCtgctcacgtagaacggcgtgtatccggtagatgaatgctctgcattgttcagcgg
aAATCGACAAGTTCCAGCATGGCACTCTAGCGCTTCATTGTCTcaacgcagacgctgcgaagaacctTTTCAGCAATACGgttcacgcgctcagattgac
catcggtctgcggatggcccgttgttgacatatccagcttggtgaccagcaccttgaagatcgtcgaccaaaacttcccagtgaaacGTGGGTctttgtc
agagacaattgactccgggagtccatgttgtcgaaagatacaatccacaaacagcgttgctcgacatcgtcgatggtgtccgacactgtcgcaagatgag
ccatctagCTCAaatggtccacaaagaccacacccttgttgcccgccgagtccttcagcAGTCCAAATACGTATGGAATGCCAAcacactgagtggggtg
tcgtggtgtcgtgggcctcatagaggatagtACtttatcgtgaggaaccacaattcgtggcgtatctgtCAagttggtgctataatacagcgaACCATTA
gtcaatgaatatcggtgcaaccgtgctcGCAGTCGCAACAGCAACTTCCTGTttgagttttcaaactccttgctcccgagagtctgtagcagcgctatgc
ACATATCATTACCCGCGTACGCATCGCAGATCAAATgcgtcacggacgacgtcgtcgtgacatgagcgagctcatagtctggtcatgacgcatcagccaa
atcattttgctttcccgcGAATACTTCACcacgaagttatattttgcgaaAAAAAGAGTCACCTGGCCATCTTATGCGAGAGGCGAAACGAATgaatcgc
agtgcgtagtgacgcattaTCTgggtagatcacaaacggcttaaaGCCGAGCATGTGCactttgaacttgacaagtgcatacttcatcgcaagtagtctC
TTGTCGTAACTGGATTGTTCTTCTCTGCGGCCTTGATCtgacgagattcgaatgcgatcaccAGATCTCGCCTGCTTGCACCAGTCCACAGCCAATGGCA
AGGTCTAAGTGTCACAGAAGACACTGAAAGAACGATCTGCGTCTGGCAACGTCaaaattggtgcatgaagaaggctgtctttgttCCAATCAAAAGGCTT
CTGATGCTAGGTGTCCCAGCACCATTCCACattcttcttaaggagattcgaatACAGCCgtgtcatttctgcgtagttctcactgtacttgtgcaagtag
ctggcgaggccaagtcgCTTGTGCAAGTCCTCtgagttctttggaaccgccCAGTTCACATTGGCCTAGACCTTAGCAGGATTGGCTTGAAGGCCACACT
TCTCAATAAAGCACCTTAAAAAGCAAATCCCTTCCGTGTCGaatatgcacttatcggcattagcatacagctttttcATGCGTATGAagtcgagcaccgc
tctcgaaTGGACGATATGGTTTTTCACATCTGTCTtttcgtgccccgcacgtttgtggacaaaaatgtcgtcgaagtatatcTGCGCCCGATGAGGCCTA
AACAAttacgtcacaagacgatttaatgttgcagatgcatttgacagcccttggggcatcacaagccactcccagagcatgccgattggtaataactatc
gaccaagtcgagtgcgctgtacttgtacAGCCTTCCATGCTTATTCGGAGAATATCCTTTTTAGGAATCAGCGCTTAATTTATTacaagcgtgaacgata
cgccacttgccgttcggcttccgaaaacAAAACGAgtgtgtcgaatgggaaacTTGctttcacgcaccattcctgcctcgtacTACACACGGAAGCAGTC
TTCAgagacgtcgcactgctgctTGGGCAGatgccattggcgtgttacgaaGAATTTGGtccccggaaccaggtcaatctcatgacgcacacctcagtcc
ggaggtagatgcgacggcgggtcttcggggacgacgtcttgaaattccctTACCAAAGTATAACAAGGACCCGAGgggtccttcaggatcgataaTTCAG
TTCGCGCGTTTAAcatcctcttggtgtcctcca