Description :
From Genome Similarity Track
Location :
Scaffold_100:62168- 68088
Transcript NameFunction/comments
g8732.t1hypothetical protein
g8733.t1hypothetical protein

Sequence
5920 bases(100 bases per row)
CTTAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCGATAGTGCTGCTGAGATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTG
GAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATTAAGATTCCACGTGACATGCTCATCGACAACCCGCCGGTGATCCAGATGAGGAC
GAGGAGATCCGTCCGGGAGCTACTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACT
TTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTC
CACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTC
AAGAAGGGTATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAATGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCA
TCCACGCCACTATCATGGCCGGCGACAGGCAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTCG
ACTAAGACGCAGGCAGTTTCCTATCCAGACTGCATTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACT
CCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCGAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAG
ACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGAGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGT
CGGTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAA
CCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACTATGTGAGACGAGCGCA
GCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGC
CGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGAGATAAAACATAACCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGA
GCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTC
CGTCTGTCCGTCATTCCGTACGCACCCGGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCAT
TCGCTATTAGTATACTACGAGGCCTCTCATTGGCTATATAGTGGAGCCTCTGCGCGATTGGCTATTATAATGAGTAGTGTGGACTACACCACATCGGAAT
TAGCGGACTGAAATCACAGATGCTGATTGGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTTCCATACGTGGTCGAGTTTCAGGTTTCAGGGA
GGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCTTAAGGTGCGTCT
GACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACAC
GAGGTACACAATGATCTGGGAAATGACTACATTAAGATTCCACGCGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGAC
CGGGAGCTATTCCGCGAGGTAAGGTGCAGGGACAGACTGTGCAGTACCTGGGACTGTACTTGGCGACTCCATGCTTTTCCCACGGTCAGCTGTATGTGGC
CATATCGAGGGTTACGTCGAGATGGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGGAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGA
CAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGCAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCAC
CATTCCCCCTCGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGCGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCG
GAGGCGAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGC
GAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCAA
TAATAAAACATATCGATATAAAATATAAGCCTTTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACC
CACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGC
GTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCTCCCCATTCGCTATTATTATACTACGAGCCCTCTCATTG
GCTATATAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCGTAGAGTGAACTACATCACATTCGGAACTAGCCGAATGAAATCACTGCTGATTGGACAA
AATATACCGCCGTTCAACAACTTTTCTTTTCATTTCCATTTTCAAAACGACGCTCCGGCGACGGACCAGCTCGACGGAGGACCGGGCGGGATAGCTTCGC
AGGCAGGTCATCCCCGCCGCAGGCAGGGTAGGTATAGATTAATCCTATTTAATTCTAATACATAACGATTTCGGGAGTGCCGCCTGTTGCGGATAACTGG
TACCTTCAGGGCAGTCGAGGGGTAACCGTGCGTGTTAGAGGAGGATAACCGGAGCCGTGCATTGTGTGGGAAGGGCACAACTGCATGGAGGGATGGGTAC
CCTATGACGGCCACACTGATGCGGCCTAGCCAGCCCCCAAGAGGATCCCATCCCTGCCCAGCGAGCCAGGCCGACCTCTCTCGAAGCAATCGTGACGGTT
ACCCCGTATTTTCGGGCTTTCTGGTGAACATGCTATTTTGGGGGGCTCCCTTCACCCCCGGGAAGCATAATTCCAGGTTAGAGGTCCGATAAAAAGATTG
CAGCTGGCGCCCGAAATGCGTTCCAAGACAGTCCGCCATCCAACCTGCTCTTCGGAGCCGCGGTGCTGAGGCGCCCATTTATGCCCGCCGGCATAGTGGG
AAGTCTCATACCAATCCGGGGGACTGGGATGGGTACACACGGCGATAAAAGCCGGCCTAGCCGGGTCGTCCATCCTAGCCCCGGGCTTGACGCCGTGTAA
TGGGACCGGCCCATAGTGTGGTAACATGCTATTTGGGTTTCTGTGCAGTTACGGCTGTGGCGGACACTTTCCAATCAAAAGGACGAGTCGGCACTATTGT
GACAAGTGAGGACCGCTCGACGGTGGCCATTTGCAGTGGTACCGGTGGAAAACCGTTGGTTTGGTGCAGTCTGCGCTCGAACTCGGGGTTTGTACGGCCC
TTTAATGCCTATGATGCCTTGCTGCTAAAAAAAAATATTAAAAAAGATTCCCAAAAAGCTGACACGTGTCCCTTTACAACCAAAACGGTTAATTGCCTGA
GCTGATAAAGCTCAGTGGCATTGAGCGCGACCGGTAGACCTCCGTTGCCAAAGGAAGCAACTAAAAGAAAAGAAAAAAAAGAATTGAGGTACCGAGTCGC
GCTTCAGCACCTCGAACCCGCAGCTGTGTCTCCAAAGGTATTGAGACGCAGCACCAATGCGGGGGTGCTTTAAAGGGATAACGGTGGATGTGAGGGACCA
GAAACAAACAAAAGCAAACGCGGCAAGGCTAATGAGGTGTTTTACAGCCGTGCAGGACTCGGGTTCGTGGCGAGGACTGTGCAAGACTGGCTACACGGGT
ATCCTGCAGGTGTGTCTCCAGAAGGCGTCTCCTTGCGAATTGCGAAGTATCGACCGTCCTTTTACTAACGACTGCAGTTTTGGGTGGTTGTTTTCCAATG
CACGTGCGCATTTATTGGGAAGTCCACTAACGCTGCATTTGCTGTTGCAGTTGTTGCGGACAGCACCATGGTGAATGTCGGCAGCAAGCGGGAGCGGTAC
GGCTGTTTCTTGGTTGTTGTCAAGTGTCCCTTGCTCAGTGGTCTCTTTTGTTAGTGATGAGCGGCGTCAGGAGCTGGACCAGCGCCATACCCAGGCCCTC
GATGCCAACGCGTCACCACAAGGATATGAGTCTCCAGCGTCTAAGAGGCGACGGTTGGGGCGCCGCCGCGCGGCTCAAAGGCGGTTTCGGGTGGCAATGG
AGCAGATGGAACAACTGAGCCTACAAGAGGCGGCCGCAGGTGGAGGGGACGTCGTCACAGTGACAACGGGTGAAACCGCCCCTCCTGTGCCGACGGTCGT
TGGACAAGGGGCGACTAGCCAGCTCTCTGCAGGTGCTCCAGTGCAGAGGGCGACTGACCCACAAGCAAATCCACGTCGGATGAGGGAGGCGCAGCGAGCG
CGTTCCAGACGAAGTAACATGACCGACTCTCAGCGGGAGAGTGCGCGGCGGCGTGACGCGGAGCGGAAGCTAGCCCGGCGAGCCCAACTCCGTGCCGAGC
AGCTTCAGGACGTACGAGAACGAAACCGGATCGCACAGCAGGAACGTCGGCATAATCTGAACGAAGAGGTCCACGCCGCGGAGCGTGAACGCAACAGTGC
TTCTCGCGCGCTTCACAGGAGTGTACAGGATCGCACTGAAGAGCGCAGAACAGATCGTGAGCAACACGCGGAGCGCAGATCACAGCTTACGCAGGAGGAA
CGCGCCGAAGAACGCATGGTAAACCAAGAGCAACATGCGGAACGCCGCAGAGAACAGACTGAGGAAGAAGCACTGGAGCAACGCGAGAGAGAGCGATTTC
GGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATCGGCT
TCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCCTTTA
CGGCCTGCACCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATTGGCG
CTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGGGTCA
CTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGACCCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCAGCAG
CGCGCCCAACGCCGCAGAGG