Description :
From Genome Similarity Track
Location :
scaffold_40:62167- 65911
Sequence
3744 bases(100 bases per row)
TCCCGCAGCAACTACCCCATGGCTAAACGAGCAGCTGAATAATGCGCTGTCATTACAACCGACGAACTTGGGCCACGCCAACCAACAGACACACGGCGGA
TTCTTCAAGAATATGAGACGCATCATATTACTACGATTTGCAGACTCAGTACCCGTTCTTAAGAAAATTACCGATCCTACCATCGCAGACCCATTGCGAC
GTTTGGATCGTCACATATAAAGTGGACCTGGCTGAGCTAGCCGAGCTTGCCCATATGCAAAAGCATGAGTCGCAACGACGTTATTAGGCTCAAATACGCC
GAAGTATAATTCGTATCCAAATTTTCTACTGCCCGCGATTTCCGACCCTTCAGGTCACCACATCTTCATGGACCACATCTTCATGGAACCGCCTTTGCCT
AGAGCAGCAACGGTTAGATAAATGAATAGATTTGTATCCTCTCTGAATACCGCACCTCGGTTAAGGGATGATCGTCAATAGCGCACATTTCTTGCGCGCA
GCCACCAAGCTCAGACAACACAATCGCGATGCGCGGTTTTCCTGTTTGGAGCATATTCGAACCTATGACCGTCTGTCTAAATTTTTAATGTTTAATTACA
TATGTCTCCGTTCATGCACTTAGCGAGCTAGACGGCGGTCTCAACGTGCGTGTCATAAGTTTTCACACCGGTGCCTAGTTGAAGCGCATCTTGAAGTATA
TCACTGATAAGATCTCATACCCAGTGAGCGTATCCACATTAGTAATTACGGCATTTGGTATACCGACCACTCGTCCCCGTCGAAATATGTAAACTTGAAA
GCGTGTCTAGTTGTTTCGAGAACCAATACATGTTCCATACTCACAGAGATTAGAGTCCTTTCACGACTGTCGTGGTTCAAGTGCTGCGAATCGCAATGAG
ACATCCGCGCGCGTTGCACCGAAGAAGCTTTCACTCAATTTCTAAACTAGCAAATGCATAGAGGTTAGGTCTTAATGCTCGACCCTGGACCGGATTCGAC
AGCGATTAGAGTAACTGGGTACTAGGTTTCTGTTATTGTAGAtatattttaaatttaagggagaataaaaaaaatgccccaacttttgccatatataaaa
aatatcccaacttttcNNNNNNNNNNGTGTCCCGTGTCCCTATGTCCTCATACCCATGTCCTGTGTTCTATGTCCCATGTTCTATGTTCGTGTCTCTAAA
AGCTGATCTTGGGTAGCGGTGTGGAGCTGTAAGAtagtttttttttacttgaaGTGGTTTCTCTTTCGGAATTAATATGGCGTCTGGCTGATACTTCAAC
CACTGACCCCCGATACAATCTCagttaagaaaaaaaaatatatcctTCAATCGAGATAGAAGCAAAAGCACTTTCAGGATATTTACGTCCAGAATTTTTT
CCTGTAATTTATAGctaaaatatctttaattttttattaatgtatactttgttattgtagGGTATTTTGTAAAATTATGCtgattcattcctaatacaat
acatcttctgttgtgtaatattacggctccccggtgataattcacgtgctggggtatttttttttattttttgaaaagttgggatattttttttatatat
gNNNNNNNNNNAACTTCGTAGTATCATTATCTAAGTTCGCGCAATTTTTTAATCATCAAACTGAAACTGGGTACTTGACGTGAATTTTTGGAGGTGGATG
CGCGTGGTTGGAGCGTGGGATGTGGAGGCTCTGCCAAAATACCAAAGCCTAATGGCATTTGATACCAATGTCTGGGCTTATAGGTATAGCGAGGCATCCC
AATGACGGTAAGCTTCACCCTGCATTCAAAGGTTGAGTGGGTCTCTTAGCTGCCAAGCGTCACAATGGTACTCATAAGGTGGCActatcattttttttgc
tcAGCGGGGCCTAGTCTCTCTCGGTTGTGCGGATTACAGGGGTGTTTTTTTGCAGGGTCGATAGAACGTTGTAGTTCCAGCACGCACAGTAAACGGAGTT
TCACGAGCCCTGTTATGAAGTTTGCGGGTCactcaagatggtgtgagcacttaaacaagaagtcagtacgtggctggactgccagtagttatatatTTAA
TTTGGTTTTACTTATAcgtaggaaaatctatagctttagatataggcggctttgccgcaaataaaaccgagagtTACATTTTACGTTTTAAACAgatgag
ttaattagccctgGGTTAGAATTATAatttctcttggagtaaagAAATTTAAATCCTATAAAcacgtactggttctaagtatagaacgaaggccgccaac
cttaaccaagcttcctctaagcgagatatctacagcagccccgcggctcttggtagcacttgtagtcaatctacacctgagccgTTACGActcattctct
gtgaggatagtgAAGTTTTCTTATTTGCCCAAGGCATTAAAGACAGGCTTAAAAAGGCGatatctctgcttggccctgaaggtgtacaacacctcgcttt
gcAAGAACTTGAAGCGATCATCGCGCGCCTTGAGGCAGTTTTGAGTTAtggaaatgctctgctagagcacctacagcagaagatgtcggcttcgactgcg
tccagaacgccaccgtcgacgacagatGACTCCCCCCCCGATCCAAGCCTCGCATAAtgagtgttaagaccttcgagggtaaggatgaagATAATCTCCT
GCCCTCGGTGAGAGATGTCGAGATGGTCACGGCGGTTGCCATGCtctagaccgagcaacagcgcatgccgctagccatctccaagctcggtggtcgagcg
cgagaatgggcactgacgcgTGGCACTTCGGttaagcggcgtttcccacTTGGACAGAGCTGAATCTGCNNNNNNNNNNATCAAGAAGAACAGGTTGCCC
AAGGGGCATTGCAACCGCATCAGGTTAAGCGATGTCGACCATCGCGACATCCGTCGGGGCTGGGAGGGCTTCAGAGGCGTCCATTGCGAACAGTGGAAGA
GGCTACTATTGGGGTGATCTTAATTCGTGGTGCAAGCGAGGCCGCAAATCGAGAAGTAGGTATTGCATTAATTAACATTTTTGACAAACATGAATTTTGT
TGATGTAGAAGACAATGAAGTACCAAGCAATCATGCTGGACTAATTTGAAGCCAGCCACAAGCCAATGGTAGTCTGGACTGTCGCCATCGTTCTAAGAGA
TTTCTGCATTTCCGGTTTGCGCCTGAATACCACTCTATTTGTGGGGTTCGTCACATCTAGCAGTGAAGCAGTAATTGCTAGGATTTTTAGCTTTTCTAAT
TTCGTGACTATTTGCTTTCCCACATCTTCGTTTTTCTTGATTGTCattctcctcttcttccgccTCTTGAAGCACGGCTATAATCTCATTGTTATTCAAA
TCCAGATTTGCTGTGTCGTCCTCCATCATTGTACTCAAAAGCTCTTTAAATATCATGGGATTTTTAAGAGGAAGCCTCTGACTAGCGTCGCACAGGTCAA
TGTATTGCCCTCCATATTGGGCACCGATATATGAGGAGGCTCTGCAAAGAGACCAGtgtggcaaaaaaaattggccACGGTAGCTACTGAAATCTCCTCC
CAAGCTGCTTTGCGCCATCTCATTGCGGTTAGCTGATACCTCGATTGTCACGATCAACAGCATTTTAGTGATGATATTTTCCGCCATATCGCTTAAACGC
GAAGATTATTTCAGCATCCATGGGCTGAATCTTAGGCGTGTAGT