Description :
From Genome Similarity Track
Location :
Scaffold_23:62157- 64426
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.43Ribosomal protein
Pytap_DAOMBR444maker-pag1_scaffold_23-snap-gene-0.66Rho-associated protein kinase 2

Sequence
2269 bases(100 bases per row)
CTGAACCGCTGAACCGGTCCGACCTACCCTTGCACCAAGCgCGAACCATTGGCTGGCCTGGGCGGGTCAGCGCCTGCGGCTGGGCGACTCTGCATGGCGA
CACTATCTCATTCGTGTGTGAAGGCAAAAGTAAGTGGCGCTGTGCATGAGGCCcTGGCTACGAGGCGTAGCAGGGGCGGCATGTGTCTGCCGAGTCGCTC
ACGCTCTATGGTGCTGCTTGAACAGTGAAGTTCAACTCGGCTGTTTCCTCGTCCCGCCGCAAGTCGCGCAAGGCGCACTTCGGCTCGCACTCGACTGCGC
GCCGCGTGCTTATGAGCGCGCCGCTCTCGAAGGAGCTCCAGAAGAAGTACAATGTAAGTTAGTGTGAGCCAGCCCACCACGGCGACACCACTACACTTTC
AAACGTATAAGTCCATGTCAGTGAAGCGCGCGCGTCTGGTCCTTGGACCACAGGCCGGGCTTCGTACACACTGGCACTTCATGGCATCGTATGATCTGTA
AGTGCGGATCCCAGGCTCGCGTTCATGCCACCCTGAAAAAGGGTCGCACTAGACGCGTTGGAGATCTTCTATCTGTTCGTTGACTGGCGCCTTCAGTTCT
CACTGGAGTGTTTGTTGACGGCGGATGGCGATAACCCTCTCAGGTAACTGCACGACAGGAGCACTGACTTTGCGATTGCGATGTCTATAGGTGCGCTCGC
TCCCAATCCGCAAGGACGACGAGGTCACCATTGTGCGTGGTTCGTTCAAGAACCGTGAGGGCCGTGTGACCACCGTGTACCGCAAGAAGTTCGTCATCCA
CGTCGAGCGTGTGGTCCGCGAGAAGGCCAACGGTGCCACCGTGCCAGTCGGCATTGACGCCTCGAAGGTCGTGATCACCAAGATCAAGCTTGACAAGGAC
CGCAAGAAGATCCTCGAGCGCAAGAACCGCTCGGTGGCCGACGCCAACAAGGGCAAGTTCACCGAGGCCGATGTGCAGATGGCCAACGTCGACTAAGCGT
AGTCTCAAGCCATCCCACCACACACGCCATTCAGTCGAACTCCTCGTGTAAGGAACGCACGGACGTCGCAGTTGATACTTAATCGATGAACAAGACGCTC
GTACACGATGAGAAAGCACCCTATATGCGTAGCCTCTGTTTGGTTTtATTGTctGTGAATTGTCAAAACAGCGACAGCTTCTTCATCTCTTCCTCGATCA
TGGCTTTCAATGCCATGGCAGGTTGATCGCTGGCAAGATCCACGAGTAGATTGATAAAGTCTGCTTCACGTTCCGCGTACTCGCGCAGCGATAGTtCTTG
CATCTCCAACTTTCGTAATACCTTGTTGGCCAAAGGCACAAGCTGAGGAATGCTCCGTTTGATACCACTCATGAGCCTGTCTTCATTCTCCCTCGCTTGG
CTGTCTCGCTGCCACCTCTCACCGTCCAACCAGTTATtGCTGTCGACTGATGAGCCTCGTACTCGCTGCATCCGATCGCCATGCTTCCTTACGAACTTGT
CGAGCACTTCGGCCTTCTTCTGTTCGCTCTCGACAGAGGCCAAGTACATCCTCGCGGCCAGCAACTCCTCCGTTGTGGTcGCCTTTTCGATCAGCAAACG
CTCGTTCTCTTGTTGAAGCTGTTGCGCCTCCTGCTGTGCCAACACCACCTCGGCACTCAGACGCTTTTGACCCAAGCGGGTAGTTTGCAGTGCCTCCTCT
CGTCGCGTAAGCTCTTTTGACAGCCTGTCAACTTTCCGAGTGGATTCACTGACCAGCTTGCTTTGCGCCTGGAACTGACGTTCTCGCTTACGGTATTCAT
TCACTTGTCGCTCGAGCTCGCTTCTGTCTTGAGCCAAGAGTTGATATTTCCTCCTGAACTCCAACAACTGGGCACTTCCGTATGAGTCCGAGTTGTCAGG
AGACGCCAGCTTGAGCTCCAGCTCGATATTCTGCGTACGCAGAGTTTGTACTTCTCGCTGGAGCTTGTGGATCTCTTGCTCGTACTGTTCGAAGACTTGG
GGACATCCCGTTTGGATCTCAAAGCCTCGCACTTTTGATTTGAGTGCGACTGCTTCGAGCTTGAGATTGTCGATTTGCAACTCGTACTGTGCCTTCTGCT
CTTCGTGGTCGTGCAGCGCCTCGTTCAAACGTATCTCAGCAGCCTCCCTCAGTGCCTGCTGTTCTCGAACGACTGTAAGCAGCGCGTCATAATTCTTTCG
CAAGAGCGCTGCATCCGTGGCTTGGATTCGTGCAGCTGTCGCCGTGTCCAGCCCATCGACATTAGGTGG