Description :
From Genome Similarity Track
Location :
Scaffold_49:621363- 622927
Sequence
1564 bases(100 bases per row)
GGCCTTGTCGGATGAACCCTCGCTACTGAGCTTCGAGTTCACCGACAGGCATAACATACTCAGACAAGCTTGACCAGACGCTTACCTTGAAGCCGGACGT
CGTTCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTATGTTTACCCTTTCGGGTCTATTCCTAATAAGAAGTCCTATTCAAGTATACAAATATCAGGT
GACCAATGATCCGTTATGGATCTTCTTGCACGCCAACCGTCGTCTACACCGTCGCATGAGTATCTTTAATGGCTCGCGCTCTGTACCAGACGGTAAACGT
GGCTTCAAAGGGTCGCGGAGGCTTCCGGGAACCCATCCCAACCGCCACCGAGGGTTCGTACCGTATATGGGCAGTTCTTGGACGCTGAATGTGAATCTGG
CCAGTCCGTTATTCTCCGCCTCTTAGCCTTGTAGTCTGTCTGTCTGTCAATAAGTCCGTCGGTTTCCTTTCTTGCTGCCTTTTCCTGCCTATCAGCATGG
CTACACTCGGCCTGTCAAGGCCTGTCAAAACTATTTTCGTCCCATCTTACCGTAACTATCTTTCTGACTCGACCTAGCTATGCAAATATTACAAATATCC
TCAAAAGCGTCACACAATTAGCTCGCGTCCTGATTGGACAATATTCTCCGACTCATTTTTCATTCAAAATACAAAATTGGATTTTTGAGCAACGGCGCGG
CGAGGATCGCAAGATGCGCTGGCTGTATAATAGCAGCAGGGTAGTTTTAGATGTATATGCATGGATGTACGGGCGTGGGGCTCCTCGCCCTACTATATAG
TAAAGCGTGACCTCTCAGGTACATTCTGAGGCTTGCCCCGAGACTCCAAAGTGATATGGCCGTTGGTAGCGATAGCAATCAGGTTGGGGTGGGTGTAACT
GGGAGCGTCTACCACCATGCACGCTCCTAGGGGTCCTAGATCCACCGCGAGTGTCCACGCTCCAAAGCGAGTGCCGCGTGCTGCCAATTGGTTATACCGA
AGTTGCAGCCACATGCGGAAGAGTCATTACGGTCCCGCAATACAGAGAAGCTCGAGCACACCCACTGCCTTTCCGCCACGGCTTACGCCCCCGTCGTCAG
GAGTCGAACGCTCCCCGCCGCGAGAGCGCGGGGATGATAGGTCACTAGTTGAGCTCAGACTCCGACCAGTGGCTGTAGCAGCCGGCGCGTAGGAATGAGC
GGCACTCGCAGCATGAGCGGTGACGCCTCGTGGTGATGGGGACGGGGTCCCTAGCGTTGACAGCGTGCTTTCGAGTTAGTGAAGTCCAAGCGCACACGTC
TCTTAAGACGAATATCGGTTTAAGAGAAACTTGCTTGAAGAGCATCATAGGGATCTCGATGATGATGTGCTGAGGATTGAAGCCGCTCGAGGCCATGTAG
TGGAATATCAGAAGCGTGGTCTTCCCCATGTTCACATACTGTTTATCCTGCGTCCGGAGGACAGGCCCACTACCAAGGAAGACGTCGATAAGCTGGTGTC
TGTGGAGTGTGATGTAGTGATCTCTCCGAAGTTGCGGATTATCACCCGTCGACAAAGACGTGAC