Description :
From Genome Similarity Track
Location :
Scaffold_79:6213- 9354
Sequence
3141 bases(100 bases per row)
CAGCCCACCCTGCTGGATAGAAAGCGGGGCCATTTTTTGTGAAACCCAAGATCTAAAACGTTTGCCTTCCCTCTCCCTCCAGATAAGTCAAGGATTATTC
CGTGAAGCCGTGCGACTATCCCTAGAGGCAGCCAACAATGACGTGCCAAAAAAATAATTTTGGGGACCACGACCGCGTTAGGCAGGTGAGCCCGCTGTTC
CACTGTGTGCGTTTTCGCTCGAGCAAGGACGAGCCAAAACCAGATAGATTGGAGTCCGCCATCCCCAGAAGCCGTTGGCAACCGCCTCCTCATCGAACCA
TATGAGAAGTGCATGAAGCTGGCGTTTCAAGACCTGCGCACGGCGGCGGCCGTGATCATTGGCATGGACGTCGCGACAAATGTCCTGTCATCGTCCATCT
CGTGAACACGCCCCGGCTCTAATTCGTAGAGTACCTGCGGCCTGATATTAAGAAGGAGTCGGCCAATGAATTGCTGGTGAAAATTAGGGCCTCGATCGAC
GCGTTGTTCCACTTGGTTGGTCAGCAGATCGTGAACGGGTTCACATCGGACTCGTAGAACGTGATGCGTCGTATGCGGGCCAAACTCGTTGAGGAGAATG
TGGTCGACGTCTCGTACGGATACGCCACCCACCCAATTACAACCTGGTCGAGGACTTGCTAAAAGGGAACTGTTTAAAACATTCCTCAAACAGGCCATGT
TCCTGTTTAAGGCGGTGAAATACCAGGGTCTTTTGAGAAAAATCTTCTCCGTCATCTGCAAGCGGCCGCTTGGTGTGGCGCTGGTCATGGTTCTGTTCTA
GCAGTCTTGTTGGAGCGGTGTGAAGTACAAGTTCCAGCACCTCCGAACTGTCATGCGGCCCATGTCCGAGATGCCATTGGCAGTCCGAACCTAGAAAGAG
CAGCTCGGTATCGACTCGTCGTTCTCGCTGCCCCCTGCCTTCGCCAAGATCATGCGAGACGATCTGTTCAGGAAGGGAGTCGCCTTCTCCGCCGACGTGT
TCGACCCGCTTTGCAAGTGCATCGGCGTGCTGGAGTCGGACTCGGCGACAATGGGGACCGCCTATGCATGCTTCCTCTACATGCTGGACAACCTGAATGG
TGTTGTTCCCGACTACGATGGCCAGCGCGAGCATGTCATCCAGATACTGCCTTACCGCTGGATGTGCATGTATAGTCCGTTCCACGCGTTGGCGTTATAA
TGTGACCCCTTCTACTCGGAGTTGCACCTAAATTTAACGCGCCACCATGGGGCGCTCTTCGTCGAGCTTGGCATGGGCAACCTGCGGCTGCAGTGTCGCA
CGGACCTCGCCCTGATGGCCTGTCGGCACGATGATCTGGACGGTGCTAATCTCCTCGGCCAGTTCCTCGACTTCTGCGTTCATCAGGAGGCCGTGTTCAA
GGAGAACGTCGCAATAAGCACGTACCAGCCGCGCATGATCTGGTCTTAGATTGGGGAGAGATGTCCCCTGCTCGATTTGTTTCTCGGCCGCGTGTACTGC
GGGCCGGGTTCATCGGCCGGCGTCGAGCGCTAACACAAGACCGGCAAGCGAGTCCACACATCGGAGTGCAACTTTACCGGAAGTGGCAAGGTCAAACGTC
AAGTTGCGGTGGAGTACAACAGCGCGACTTCGCAGTGTGTCCTGCTTCCGAATCGTCAGCCCTTTAGACACGTCATCGTCGCTCTGCGGAACAGAGCTGC
CCAGGTCGACACTGGTCTGATTGACAACGAGCTGTTACTGGCGGTGCGACGCCAGCACGGCGATGGTGGAGTAGAAGATTTGGAAGGCGACATCGACCCT
GTCGATCTGCTGCTCGACGACTTCGAGCGGGCAGAACAGGTCCTCTTGGCGAATCAGCTGCGCGATGTGGAATCACCTGAGAATGTTCTCGACTTCCTTT
GGTTCAGCAAGAACGAGGTCGATGATGATTGTAGACTGAACAGTGAATCCGTCCCGGCCACCGTTCCCATTTCCCGAAAAAAACGTTTTGTTGAATTTCG
CTTATATTTTAAAACGCGTTTGAATATGTTTGAAAACGTTTTATTTTAAATTGATTTAAATCCAAACGGATCTATAGTATGTGTCTGTAAATAACGCTAG
ATGTACCTTACACGTCTTACTATGTGCGTTTTAGTCGGTCACCTGCTGTGTATGTGAATAACGCCAGGTGTAACTTACACGTCGCACTAAGTGCGATGTA
ATTTGTTGGTGGGTAATGCTAGGTGTACCTTAGACGTCGGTCGTACTACGACCGATGTAGCCTGTCGCGCATTTTGCATTTGTTTGCAAATAAACACTAG
GTGTACCTTACACGTCGTATAAAGTGCGATTTAACATTTATCCCCTCTTCATTGACGTGTTCAAGAGACGACCGGGCTTAGGTTGATGTCAGCTTGAAAA
TTATTCTGCAGGGTAGGGTAGGTGTAGTGATGGTTTGTCCGCTATAAATTAGTTGGTGATAAATAGACTTGAATTCTACTCCTTCTACAAACAACACGCT
TCCCCCTTCTTTGGGCAAGATATCTTTGGCCTCTCGATGGCTGAAGGTGCGCGTGTCTCAAGGCAAAAAAGACCGATAGTGTAATGTTTAGCCAAGATCG
CGAAGACCGATCCCGGATTGTTTGGCCTGGATTGCGCAATTTCTTAAGACAAGACTACTGCGATTGGACGCAGCAACAAAGAAAAGGACTGCGTGACCAA
GATCGACGAGGTGATCTGGCACAGTCTGATCCGAAAATCTTGAAGCGATCTATAGGTGAGCCCAAGCGCTAGAGACAAGAGATGAGATCAAGCGGGATCA
ATCGTCTGCGACCAGAATAAGAGATCATTATTCAGATCGGATCGATCTCAAGTGAGATCGATACACGAACATCCCGATCGCTGTGTGAACATTTTTAAAT
ATTTTTTTCGATCCCATACCCTAAGCGAGATCGACATCTCCCAAGGCCATGACGAAGAGCTCAAGCCAGCCTAACCGACGGGTACAAAAGGTAAGCACAA
GGCTATACAATAAGGCACGGATCGGAGGACCCTATCTGTAAGTTCGGCATGTATGGGATAGTGGAATATTAAGACTCACATCAGCAATTTATGACATCTA
CTTCGACACACATGGATAACGCCGTCTCGGAACAATTGATA