Description :
From Genome Similarity Track
Location :
Scaffold_1328:6213- 7372
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1328-snap-gene-0.10Function: syntaxins are involved in intracellular vesicle trafficking
Pytul_var.sporangiiferummaker-pug3_contig_1328-fgenesh-gene-0.4Mitochondrial Protein Translocase (MPT) Family

Sequence
1159 bases(100 bases per row)
CCGCGATGTGCTCTGTTGCAGCGCAAACACGCTCGTGCCGATGGCCGCGACGTTGCCGGCGCGGATCTTGGCGGCGATCATGGTCTCCTGGCCGCGCGCA
TTCTCGAGTCGGTCCAACCAGCTCGCCCACGCCGCTGCGCTCATCCTTGTCTTCTGTTACGTGCTGCTTTCCTTTAAGCGCGTTTTCCCAGAGCCACTCC
CCCACACACGCGCGCGCACTCGTGCCAATGTGCTGGATCGCTTTGTTCTCTTTCTTCCAATATTTTCGAAGGGACTCCCGCTTGAAGGAATCAGGATCCC
TTGTTAGAGTAGCGCAATCCCTATTTTAATTATTTTCGGGATAGAGGCCGGCAATTTTAAGGATCCGCGGGATTCTCGTGGGCTTGCAAATTCGGGACGT
GTTGCGAAACCCAATCAATCACCGATACAAACGCGGCGGAAAAGTTACGAAGCACGAAAGCAAGCACGAAGGCAGTCAATATGAGTCTCCAGCAACGCGA
GTTCGAGCGCAAGATGGAAGAGCACATGGAGGAGATGCGCGTGTCGCAGACCATCGCGTACTTCAACCGCACGGTGGAGCTCTGCTTCAGCGAGTGCGTG
CACTCGTTCCGCAGCAAGAAGATGGACGACGCCGAAGCGTCGTGCGTCAACAACTGCGCCGAAAAGTTCCTCCGCTACACCATGCGCTCGTCGGTGCGAC
TGCAAGAGAGCTACGCCGACATCATGGAGAAGCAGCAGCAGCAACAGCAGTAGAAGATGAGGAGTGGCGACGAGCCGACAGAGATGCCCACGAGAGCAGA
AAGAAGGTTTTCTTTGTTGACTCGCCTCTCTAGGATCAAGTGCACGAGTAAATAATGGGATGCAGACAAGAGAGAAAGAGATAAAGGAGGAGATAGCGAG
CGGACAAGGAACGCAGGGATCCAATAAGCAGAAAAATGTACGGCCCGAGAGGGTTGATTCATAGACTCCGCAGGTTGTGCTCTCACTCGAATGACTAGGC
TGACAGCCTTGATTTCCTGATTACTTACCGCCACAGTGCTGCTTACATGCTAACTCTTCTATCTGTCAGATACCCGCGCATGAAGCATCGCACGAATGTC
TTTTGCCTCATCGCCTTGAATTGTGCGAGACAGCAAAGCCTGCAGAAAGTCAAACCCTC