Description :
From Genome Similarity Track
Location :
contig_4:621160- 623762
Transcript NameFunction/comments
g1347.t1ETI31652.1 hypothetical protein F443_21403 [Phytophthora parasitica P1569

Sequence
2602 bases(100 bases per row)
AGATGAAGGTAGCGCTGTTCGCGGGGAAAGTGGAGTTCCGCGACTTGAGGATGCGTGGAGCGGCGCTGGACAAGTTCCAGCTGCCTATGAAGATGAAGTC
CGGTACTGTGGGCAGACTGAGCATCAAGGTGCCGTGGAAGAGGCTGACGTCGCAGGCTGTGAAGATCAAGATCGAGGACGTGTTCCTTGTTGTGGAGCCG
ACGAGTCAGGGTGAAGCAGGGAAAGGTGGGAAGGATGATGACTCGTATTTGCTACGTACGCGATGGGCAAAACAACAGGAAGTAAAAATGTTGGAGTTGG
TGGAGACGATGAAGAGTGATGGAGCTATTGCGAGTGGAAGTGAGACTGAAGGAGACGTCGCTGGAGCTGCAGACTCGGACCCAACTGCGTCCTGGGGGTA
CCGCAAGAAGATTCTGAACACGATTTTGGACAATGTCTCGTTCGAGTTTTCGAATATTCATATTCGGTACGAGGATTCGAGGCACTTGGCGTCTTCAATT
CCGTTGGCGCTGGGATTGACGATCGATTCCATTGTAATTTCATCGACGAACGCGAATGGACAAGCTGAATTTGTGGATCGAGCGCAGGCTCGCACTGCGT
TTGTTCATCGGCGTCTGGAGATGGTACAGGCCAGCATCTACAGTGACAATGTCGAGGTGTCAGGGGCGAAAGGAAGACAAGGCCCCTCAACTTCGGGCTC
AAATATCGTTCATCCTTTCAGTACTCGAATCAATCTTGCGCGAAATCATGATCAGCGGACTGCGGCCACTATCCCAAAGCTGCGATGCTCGGCTGAGATC
AGTGCTATTAGGGCGTGTCTAACCCCGCAGCAAAGCACGTTCTTAATTGGCATGGCAGACTTTGTGTCCGCCCATGAGATGTACTTGAAGCGTCTTCATT
TCCAACGCAAGCGCCCCAACGTTCCTATTCACTCGGGCGCTCGGCTGTGGTGGCAATATGCACTGCACGGTGTTCAGGAGTTACACCCGAGCACGCTGGC
AGGCCAAAAGGCAGCAACGACTGTAGCCGGTGGAAATTCATCTCGTAAGTCAAGTGCTGTCTCTCGTCGGTGCAACTGGAAACTATTTGCAACACTGTGG
TTCGCTCGAAAAGAATACATTCGTTTGCACAAGAATATGCTGCGTGCTGCAAAGAAGAAGAAGTTGGACGTTGAGAGTGTGTTGGCTGATCGAGCCCGGC
TTCATCAGCTCGAGGACATTTTAGATGTGGAGACTATTGTCTTTTTCCGGCAGTGTGCCACCAGAGAGATTGAAATTGAAGGTCAGGGGCATGATTCTCC
TCGAAAACTGGCCCAGTGGAAATCGAAATGGTCTTCTGGAAGGACATCGAGTGGAAGTTCCAGCACCGCATCATCAACTCACCGAGAAAACACCTTGGAT
AAACTGGATATATATTTATCGGTGAACGAACGAATGCACGCATCATCGGAAGCTCGTACCCCAAGCTCACACGAGGAAAGAAGCATAGCGGCATTGCTGA
TGGCGTTGGATCTGGTCGTCATCAGTTTCGAGGTTGTGCTTGTCGAGGAGTACAAGGTCGGAGACCAGTCGGACACCCGAGACTTCTTGCGGTTTGAGCT
CAATGAGTTCGTTGTGACAGTGCTGCAGCGTACGAGTTCATCAACTGTTTCATCGCGTATCACATCTGTTCAGATCCTCGATTTCCGTCAAATGTATGAA
GCTGCTTCGCTAGAGAAGAAGGAGCCGCAGGCTCTTTTGTCCATGATAGATTCTGATGTGTCGAGTGGAAATATTACGTCACGCAAGAGTCCGTTCGTAG
AGCTCAACATTGAAACCTCTGAGAACAAGTTCCAACTTGATTGTGGTTTTGAGCGATTCCGCTACATCCACAATCTGTACGCCGCATCGAAACTTCGCGC
ATATTTTATACCGAGAGCAGAAGATATGGTATTATCAGTTCCCGTCAAAGTCGAAGCACACCCTGTACTATCCAGACAGGCGGGAAAAAAAACTACTGAA
CTACTTCGAAAGACCTCAGTTGATAATGCTTTTGGCGTTTCTAAAAGTTCCGAAACTCGCCGAAACAGCAATGTGGGAACTTCTCGGCCAATTCATACCA
AAGAAATCGTGTTCTCGGTTAAATTCCCCGAGATCGACGTGTTTGTCCATACGACTGATGCTTCAGCAGAAGTCGAAGTCAGGCTCGTTGGAACGCATTT
TCAAAATGGATCAGCCCACAACACGTTTGAGTTATCAATCGACGGCGCGGAGACCTACTTTTTAGATGCAGATGCTTCTGAAGAAAAAAACTTGAACAAT
TCATCTGCAACTGATCCGAATCATAGGCAGCGCGCTACGCTCATGAAAACGGCTCGATTAGTATTTTACGGTGAAAAACTCGTGGAAGGCTACCTGGTTC
CGAAGTGGCAGATGACCTGTACAGCACCACCCATCCAGTTTGCGATGTCCAGTAAACAATACCAACAACTACTACAGGCATCTGCAGAATGGCAATCTCC
CAATCACGGGAACGATATGACAACACCTACTTCAGCTGCTCAATTTATTGCCGAAGACGAGCGGCTCAATGTCTGCATTTCCATTCCCCACGTATCAATC
GA