Description :
From Genome Similarity Track
Location :
Scaffold_126:62115- 64399
Sequence
2284 bases(100 bases per row)
GTCAAGATCGGACGAAGAGGCCCGCCGGTCCACCGGCAGATGCAGGTTCGAGGCCACCCGCCCCAACAGGTGCAGGCGGCCCGCAAGACGAGCGAGCACG
CCCTGGTTCTTGGCCTGGGTGGCAGTATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACGCGTTGACGGAGGCGGTCAACCTCATAGC
CCTGCGTCGGACCCGGAGAAGCACCCGGACGAAAGTAGCGCTCCGGAGGCGCCGAGTACTCGTACTCATACCCGGGAACCTCCGCCCCTGCTTGACCGGA
ACGGAGAAGTCCACTACCACGTAGAGCGGGTTCTTCAGGGGTAGCGGTGTTGCGGTAAGCGACGGTTCCTCGTGAAGTGGAGGGTTATGCCCACTCCGCG
AACTCGTGGGAGCCAATTGAACGGCTCCTGATAGACGGCCCTAAGGCTGTCGTGATCTGAGAACAGAAGCGGCGGCATCTTCGTAAGTAGTCTGGGGCTT
CTTGCCCGAACGGGGTACGGACGTTGACGACACTCTGTACCCGCGCTCGTGAGTGCTAGAAGCCGCGCGCTTCAGAATGTCCCTTAGCAGCATGCGCTTG
CTGACCAAGTGGGCGAACCGGACACGAAGGTGGCGCTGGTCTAGGATGCGGGACAGAAGCTGATCTTCATGGAGTACCCGTAACGCCGGGGGTGAGTACT
TGAGAGACTCAACCCACGCCCAGAATCTGTCCTCACACGAGCTCCAGTTGAGACAGCTCTTGGGAAGAGTCCAGGGGTAGCCCCAGAGAGGGCAACCCAG
TTCTCGGGCTTCTTACGACAAGTTGTAAAGTCCTTCAGAGGGATTAAGTGCGGCACGAGAAGCACGCACCGGGTCGCCTCCAAGTTGTCGACGAACAACT
GCTCTATGTGGACTCTGGACCAGAGCACGTTCGTAAACGCACTTAGAAGTGTGGCCACCAACAATGCCACGAGGAGCGACGAGTGTATCCAGAAAGCGGT
CAGCCCCAGAGCTCTCCTCGGGAGGCCAATAACCTCTTGAGTTGATGGCAGCTCCCTGGTTGAAGGGTCCCACCACCGGACCCCCACGTATGCGCTGGGA
ACTGGGGAGTCCTCCTGCTGCTGGTCGAGGTCTTTCGAGATCTCCCGGGGCTCAGGAATAGCACCCTCCTCCTCCTTTTTCTCTTCATCCGAGGAACCGA
AGAGGTTCCGATAGGAGTACCCAGTTTCCTTTTCTTCGCGGAGTGGAGACTTCGAAGCCGTGCGCTTCTTAAAGGGCTTGATGTCTTCGGCTTTGGCGGC
CTTAGCACGCACAAGACCCTCCGCGAGCGAGAGATGTTTGAGAATCTCCTACTCGTCGTCGCCAGCTTTGGGAGAGTCCTTAGCCTTGACGCCAGGACTC
TCAGAGCGCACAGACGTCCTGGGACTGTGATCATCGTGATCACTAGCGAGCGCGTGCACGCTGTCGTTGTCGTGCTCGCTGGGCACTGGGGTATGCCCTC
CCACGGAGCCCACAGGAGCATCGTGAGTGCTCCCGGACTCGGACTCGTCCCGGCTGCCCGAATTGAACTTGCGTTTAGCGAACCGTGCGTGCAGCGGGTT
GTCCGGAGAGACCGAGGGTGACGGCTGCTCGCAGGCTTGCTCACAGCCGCGTGACAAGACGAGCCGATCACCTCCGAGGCCACCTTAGCAGCCTCCTGGA
GTGCAGAGCCTTTACCGCGAGGCTTAGCGCTCTTGGCTTGAGCCTTTCCGGCAGCAGCCTTGGAGCGTGTTTTCGCACCGCCCTTCGCAGTGCCACGAGT
CATGCTAAAGGTTGATGTGGAGACCGAGGAGAAGAGCGCTCAAAAGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGTTCGCGCAGCCAAGT
CGATGTATTTCGACTTTGAGAATGAGAGTTTGTGACGTACACTTCCTACCGAGCGTAACTGGGGGAGGATATAGCGGGGTACGTAACCCAAGTGTGCCTC
TAAGTAACATGAATTGTGACACGTCACTCTTCGGGATATCTGGTACATGGTACCAGGATCGTCAGAGGCCCACCATTGGCTGATGACATAGCTTTACTAA
AGGTGACTTATAGTTTGTTTATTTACCTTAAGCTTAGCATACCTATAAATACATTCAGCTTACAACTTACCTTAAATTTGTCACTTCGCTCCCTTAGGTG
AAAAGGGACTTGTGAACTACTGTTCATTAAAAGTTTGTATACTCTCGGAAGCCAACTTCCTCTAGCGCAAGGTGCTATGTCACT