Description :
From Genome Similarity Track
Location :
scaffold_605:6211- 7219
Transcript NameFunction/comments
g9459.t1 hypothetical protein PHYSODRAFT_353893

Sequence
1008 bases(100 bases per row)
CCTTGACTGCAACGTACAGCTGGTTGGCGAGGGCGAGGCCAGGAAGCGACAAGTTCATACTGTTCACAGAAGAAAACAAAAATCAGTACCGGTAAGATAA
AGAGTGAGCAATGGAAGTCCTTACCGTTCAGCCTCCTTCAAGGCGATGCCCATGTCTTTGACGAAGTGCTCCACGAAGAAACCAGGGTCGAAGTTGCGCT
TCGCAATTCGTGGTCCGAGGTTGCTAATCGACCAGGAGCCGGCAGCACCGGCACTCACAGCACGAATGGCTTCCTCCACGTCCAGACCACTCTTCTGGGC
GTACAGAAGACCCTCAACCACACCAATCATGTTAGTGGCAATGAGGATCTGGTTCACCATCTTGGTGTGCTGGCCAGCTCCAGCGCCGCCCATGTGACGA
ATGTTCTTGCCCATGATCTCGAACAGCGGCATCGTCGACTCCACGGTATTGGTGTCACCACCGACCATGATCGACAGCGTGCCCTCACGAGCGCCGACGT
CGCCACCCGAGACGGGGGCGTCCAGACTCGAGACGCCCTTCAGCTTTGCCGCCTCGTAGATCTCCTTGGCCAGCGACGGCTCGCTCGTAGTCATGTCAAC
GATGACGCCGCCCTGCTTGATGGAGGACAGCACACCCCACTCCGGGTCTAGAAACACCTTGCGCACATCGCTCGGGTAGCCCACGATGCCGAACACGATG
TCTAGACTCAAAATATGTGAGCTTAGCACCAAAACTACTGGAAATTAAGTCGCAGCAGTAGAAAAACTCACCGGACACCTTTGCCACTTCAGCGGGGGAG
CTGGCAACACTCGCGCCCTGCTCCTTAAGGCCGTCGCACTTGGACAGCGTGCGGTTGTACACTGTCACCTCATAGCCGTGCTTCTACTCGATCCAAAAGC
AGTCTAATACTTAATCAAGAACCTCGATACATGTCCATTCTGCGGAACGTACCAGGATGTGGCCAACCATACTGGCGCCCATAACTCCTGTTCCAATCCA
TCCAACTC