Description :
From Genome Similarity Track
Location :
Scaffold_112:62104- 63403
Sequence
1299 bases(100 bases per row)
gATCATAGTGAGTCAATCTGACCGTTGATTACCGCTGGTTAAGTCCGTCTCGAGTGCGCGCTTGAGACTCAGCAAGTCAAaTCcGCTCGTCGCCTCGCTG
GTAGACTCGCGCTTGACTCTAGCCTTGTGATGATGATGATAAGGTGAAGTCTATTGATTTCAACATTTCGAATTCTTGACTCTAGCCTTGTCCTGCTTCA
TCTTGTACTGGCAGACATGCGATGCGTACTCTAgATCGGTCGGTCGATCCCCGATGCAGACGCGGGCATGCGACGCAAGAaGGAGCCGGCTCCGTCTCTA
GAGATCGCAGACCATAGCCTCAGCCGAGTGCACTCACAAGGAaGATCTCGTCGACTGCGACAGGCCTCGCGAAACACGGTCTACaGCAAGAGACCATTCC
ACGAGAGCGAGACTCACGTGCACAGCAGTACATACCGTGGTGAGATGCCAGAGCTACCGACCacgatgacgacTGGCGGCCCACGAAGAAGTGCTTGACT
CTGCAGTGGGCTCTGATGGTGCTTGTGCTCTTGGACGCGGAATGGAGAATggggAAGAACGTGCATGGAGAGGCAGAGACAGCgCATggccAtAcGtGgC
CcGAAACGCAGAAGGAGAGACGATGCGGTCGAGAGACcACGCCTGCGCCACCACATCCCATCACATCCCATCGCCATCCCGTCACATCAACTCTGAaGTG
ATGGCTGGTtCTTtCCGAGTCCATAaAGAAaCGTTACATACCGCCTtGcTTGGGTTACGcAtGTtGTCATAACCaCcGACAatCTtGTCATAaCCAACca
CACTCTTCGTGTCACCTtNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN