Description :
From Genome Similarity Track
Location :
contig_6:621019- 622026
Transcript NameFunction/comments
g2330.t1hypothetical protein

Sequence
1007 bases(100 bases per row)
TGTGGAGCCGCTAGTAGATGGCTTCTTGGAGGGCTACAATGCTACAGTGTTAGCCTATGGGCAGACAGGGACCGGCAAGACGCATACAATGGCTGGCTCT
GGTTTCGATGCCCGAGGTCGTGAGAAGAATGGAGAGCTGCAGGGCATCATTCCACGCGTACGGAATCAGGTCGTGATCTTTGCGTCGGACACAGGCTAAC
ATTTTCGTCTGTGTTATTCAATCGTCAACTGTAGGTGATCAAAGCTGTCTTCAAGAAGCTGCTTCAGGGTGAGAGCAGTGACAATCAGCGCCGATTTGAG
CATACGTTGCGAGTCGAGTACGTTGAAATCTACAACGAAGAACTTCGCGACTTGCTACATCCAGAACCACATCGAAGCAACTGGCAAATTCGTGAAACGG
TGAGGGTAACATCGTGATTGCCGGAGTGAAATGAGCTTGCGGATACCAAAGGGCAGTATTCAGGCATTTGGTTGTCGGAGGAGCATCGCGTGTCACTGGA
AGCACGCTAATGAACGAGCAGTCGAGTCGCCCTCCCACGCCATTTTCACTTTACTATTGGAGCAGCGCGACCTCGCTTCAGGCACACGACGATTCTCGAA
GTTCCATCTCGTAGACTTGGCAGGGTCGGAGCGTGCCAAGCGCACGGGTGCCGTGGCGGGCCGCTTCAAAGAATCTGTGAGCATTAACCAAGGCCTCTTG
GCTCTCGGAAATGTAATCAGCGCACTAGGGGATGATAAACGACGCATTGGGAGCGCCGGGAATGGCAGCGGCACTGTTCACGTTCCTTATCGGGACTCAA
AGCTAACACGGCTGCTGCAAGACAGTCTCGGTGGCAACGCTCGCACTCTCATGATTGCTTGTGTGAGTCCTGCAAGTGTGAATTTTGAGGAAACACTCAA
CACGCTCAAGTACGCGAACCGAGCGAAAAACATCAAAAACAAAGCCATCGTGAACGACCGCGTTGCGAGCGAGGAAAAGCGACTGCACAACGACGAGATG
TCGCGCA