Description :
From Genome Similarity Track
Location :
Scaffold_325:621- 5119
Sequence
4498 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGACGAAAACGAGCACAAGAA
AAGCAAGCAGTACGAGACTGGATATCTAAGATCAAAACAAAAGAAGTAGTAGTAGGAACGTAGGCTACACAGCTATACCCGCATCAATATCGCATCCATA
AACCAATCGTCGCGTGGCCGGCTTCGCTTGCGTTTCTCGGACATAACTGCAGCGGCGTGGCCGTGACCCACGCGCTCGTTCACTAGCACCGCACAACTGC
GTGGGATTGGGGGCGACGATCGTATGTGAGCTTCGGGAGGACAAGCGCCGAGCCGTCGGCTCACGCCGTGAATCTCCGAGAGCGTGACGTGGCTCAGGGT
GCGAGACACGAGCCCATCGGGGCGGGGGCGCTCGCGGCTNNNNNNNNNNCACTGTGATCCGATATGCACAAGATCAGTACTACCGGCTCATAGAATCAAT
CGCATGACCAGCATTGCTCTGCCAATCTACTCATATTCAACCATGATCTGTTAACCATCATTCTGCCTTTGCACAGGAAATCCGCCGAGGAAAAACACGA
GCGGGTGACGCAAGGGCATGCGCCGCGCGCTCCACGGCCGTGTACATGGTAAAGNNNNNNNNNNATGTCGAAAGCGTCGACCGACGCTGGCACTTGGGAT
GCAAGAGCTCCCGGATGGAAAGGAAAGGGAAAATGGAAGGTTTGCCTCATCCCATATGCACAAGTTCAGTACTATTGGCTCATGAAATCAGTCGCATAGC
CAGCATTGCTCTGCCAATCTACTGATATTCCACCAGGATCTGTCGACCATCATTTGCGAGAAACACAAGAGGATCTTCTCGAGATTCGTCTCTTCACCTT
TCATCTGCGACTNNNNNNNNNNATGGTGTGGGAACGACTGCGATCCAACGCGCCAGCGCAGCTCCCAAGGCGTCCAAGGTCGGGTCGACTGCGAGCGTCT
AAGAGACTGAGAGGATTAACCAGAAGCGGTCAATGACCGACGTCTTGAGTCGGGCCGACTTTGCTCTCTATGGTCGTGGGTGAAATTGCTGCAAGCAAGA
GAGAACGGAGGAGGAAACGGAAGTAATAGCTGTGTAAATTACTGGACGCACACGCTCATGTGCCTGCGGTGTCNNNNNNNNNNGCCTACCGAGTATATCG
GCTTTGCTCGCTACGGACGTGGGTGAAGTCGCTGCAAGCAAGAGAGAACTGAGGGGAGAACGAACGTAATAGTGTAATTCACTGGACGTAAACGCTCATG
TGCCTGCGGTGTCTCTCTAACCAAGCACAATGGCCTTTTCTAACTAAAGCAGATGAACTTGATCCCTGCTTGGGAGGCTTCAGAGCGCATGAGCCATGAG
AGCGAGGGCGCGTTCGGCCAAACGATATCCAGCGCCACCCAACTGAAGAATGGTCGCGCCCGTCCAGACGATGGACGCGATCATGAAGTCGTCAATCTTG
ATGATGACAAAGCAGCCCGCTCGCCAGCAGAGGACGGAGACAAAAATCCCATAGTTGGCGACGTTTAGGATGCCACGAGCGAGCAGTTGGACACCGGCCA
CACCCAAGTGGAGAGCGGTTGTGAGAGCGTTCCACGTCCAAACGACGACAGCGGTGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGACAAAGTTGACGACGTTGGCAATGGAGCGCGCAAGTAGTCGGATGGCAGCCACGCCCAATTCGAGACCGGTCGCGAGAGCGATTGT
GAGCGAAACACCGATAGAGAAGATGAAGGCAAAGACCTTGTGGACGACGAGATGGTACACGCGCCAGCTCACCACAGCAATGCGGTAGATGAAGTTGGTG
GCGATGGTCGCGACGGTACGAACTGCAATCGCCACCAAACGGATGACGGCGGCAAGCGAAGCCCAGATCCACATGGCAACAGTGGTGATGGGGGTGACGA
CGATCTTGTTGCCGCAAAAGCAGCAGAGGCGCCAGCCAACANNNNNNNNNNCGGAGGGCAAGTTGGTGATAACGACGACGACCGGGAGCTCAGCAACCTC
GTCGGCAATGTAGTTGACTATGCGCGAGTACACGCCAGCAGCGCAGATGCTGTAGTACGCGGCGTTGACGAGCCCGATCATGCTGTGCATGATGAGATCG
ACGAGAAAGAGGAGAAACGACATGGTGCTCCTGCGGCCCCACGGGAAACTTCAGACGCCTGCCTTTGGGGAGAAAGGAGGGATATATAGTTCACTCACAT
GTTGGGCGGGTGTTTTGCTTCGTGGAATGGGTTGGGAATCCAACAGATTTCCCCTCTCGTACGGCCTCGGTCTCGAATGCGCGCTGGCCAATGGGCTGGG
TGACGCCACCGACGTCTACTGGTCTGCGATCGGACGACACGAGCCGCAAGCACCCCAGCGGCCAAGTGCGGTTCCTGTGCGGACGGAATGCGCGCGTTGA
AGAGAGACAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAATGCGCAAATTGAGAAC
ATTTTTTTGCAGAATACGCCGCCGCGTAATATGATGAGTTACTCTAGACAGACCCTGGCTTAGAGCAGATCTGTGCCGTACTCGTGGGGTAGTTTTTGAG
GCGCGATCGTCCAGTCCCATCCACAACGCTGCACCTCATTCTGATGGTAGGGCCGTCCAAGAGCACGGCTTGTAACGGGGCGTACCCGTTNNNNNNNNNN
ACGCGAAAGAAGGCGCCCTCCAGTCGCGAGAGCACGCGAGGTCGAGGCCACGGCCTTGGAGGGCAAGTTGGTGATCGCAACGACCACCGGAAGCTCAGCA
ACTTCGTCGGCAATGTAGTTGAATAGGCGCGAGTACACGACAGCAGCGCAGATGCTGTAGTACGCGGCGTTGACGAGCCCGATCATGCTGTGCATGATGA
GATCGACGAGAAAGAGGAGAAACGACATGGTGCTCCTGCGGCCCCACGGAAAACTTCAGTCGCCTGCCTGTGGGGAGAGATGAGGGGTATATAGTTCACT
CACTTGTTGGGCGGATGCTGCTTCGTGGAATGGGTTGGGAATCCAACAGATTTCCCCTCTCGTACGGACTGGGGCTCGCTGGCCAATGGGCTGGGAGACG
CCATCGACGTCTGTTGGTCTGCGATCGGACGACACACGCCAGCGGCCAAGTGGGGTTCCTGTGCGGACGGAATGTGCGCGTTGAAGAGAGACAGGGGCGT
GTCTCTACAAGATACAGCGTCTTGAGCAGACACATGCGCATAAAAAGTGCACTAATACGCAAATTGAGAACACTGTTGCAGAATACGCCGCCGCATAATA
TGATGATTTACTCCGGACAGACCTTGGCTCAGCGCAGATTTGTGCCGTACTCGTGCGGTGGCTTTGGAGCGCGATCGTCCAGTCCCCGTACATGATGCGG
ATCGAGCTCATCCACAACGCTGCACCTCACTCTGATGGTAGGGCCATCGAAGAGCACGGCATCTCTTCTCTTGGCGTCTGGCAAATCCGCGTGGGAAAAT
GGGCACTCGTTTCTGGCTCGTTTGCGCCGCTCTGAGGTGCAATCCGCCACAGGCACAGAGATCCGTGGAAGGAAATCCACAGTGGCCGCAACCGTCGAAG
TGGGGCCATTCGNNNNNNNNNNGCTTCTCTTCTCTTGGCGTTTGATACATCCGGGTGGGAAAGTGGGCACTCGTTTCTGGGTCGTTTGCGCCGCTCCGAG
GTGCAATCCGCCACAGGCANNNNNNNNNNTAGGAGGCTGACAAGCTCAACCAATCGGTGATAAAACACAGGAGAAGATCTCTGGCGAACCACGCGTTGTG
TGAAGAACAAGCCGTGACGGCATGGGTTCAGAATGGTGTCTGGATGCACACTGTGGGGGAGGCTTTCCAGCACCGGGTTGAGCATTAAGCTAGTTTGTAT
ATGGATCCGCCCACTAAGGTGGTCTACAAAGCCTTCCTGGCGGTCGTTTGGACCAACCGAGACCCTGTTTTCATCAAATGGCCTCCGACACAAAGCCAGC
ACACCCTGACCACTCTCGAGCCTACAGCTATCGCGTGCTCTGACGTCGGCAGCCTCCTTCGTTCCCCCATTTATCACGCCATGNNNNNNNNNNGACGAAA
AGGCACGCCGCGCGGCGCGCAGTTCTCCAGCCAGGTCCCCGTGTCGATCGCGGCCAAGGAACACGAGCGTGGTGCGTACTCGCTCACTTCGGGGCCCCGC
TCTGGTTTGTCCTCACTTTGTTTCTCCGTGTCTGCGCCAGTGCGTCCACACCCAGTGCGGACCGCAGCTGGCATTCGGTGGGAAAGGAGGCGGACCAGCT
CAACCAATCGGTGATAATAACACAGGAGAAGATCTCTAGCGAACCACGCGTTGTTTGAAGAACAAGCCGCGACGGCATGGGTTCGTAATGGTGTCTGG