Description :
From Genome Similarity Track
Location :
scaffold_38:62077- 65073
Transcript NameFunction/comments
g12670.t1 hypothetical protein PHYSODRAFT_470590

Sequence
2996 bases(100 bases per row)
CTGTTGCTGCTGGGCGTGGCCTTCCACGCGCTGTGCATCCTCAGCATATTTGACATTCACTTCCAATCGCCCGTGGAGTCCTCGATCCCCAGTAACGAGT
ACACGCTGACGCCTCCAGCCAAGCGGGTCATCATCTTCACGCTCGACGGTTGTCGCGTTGACAAACTCTTTAAAGCGGTCGCAGGGCACGCAGACCGCTA
CGATCTCAATGCGGAGAGCGCCTCGACGAGCACCAAGTTCGCTTCCAATAGGCGCACTCCGTACCTGGGCGACGTAATGCGCAATCGCGGCAGTTGGGGC
GTCTCTCACAACCACGCGCCGACTGAGAGTCGACCGTGCCACGTGGCGTTGACTGCTGGAATGTACGAGGACCCGCACGCAGTCACCAAGAACTGGAAGC
AGCATCCAGTGCCCTTTGACTCGGTCTTCAATCAGAGCAGTAGTGCCTTTATCTATGGCAATAAGGATGTCGCTCCCATTCTGGCAAGACACGCCCCGCA
AGCGACGGAAGAGCACTACACGGCGAAAGAAGAGGTCGATATGATACGGGAAGACACGACGCTGCTGGATGTGTGGGCGTACGAAAAGATGAAGGATTTA
TTTGCACGCGGAGCGGAAGCGAAGGATCCAGATTTGTACAAGAAGCTGCACCAAGACAAGTTGGTGATTTATTGTCATTATCTGGGCACCGACTTGACGG
GACCCAAGTTTGGTGCTGATTCGAGAGAGTATTTGGAGAATATTGCGGTGGTGGATGAGTTGATTGAGAAGACGGAGAAGATGATCGATGCGTACTTTGG
AAACGACAGACGAACGGCGTATGTGCTGAATTCAGACCATGGAATGGATCTCCGTGGTGATCACGGGGATAAGGATCCATCTAAAACGCGGACGGCGATC
ATTGCGTGGGGGGCAGGTATCCACCGTCCTGTTGTGGTGAATAGGACAGGAGATGAGGGTTTTGATTTTGACGTGCCTACACAGTCTAAAGCTGAGGTGC
AGGTACGTCTGGAGTCCCAGGAGACTGAGGAGCAAGTTGCAGCACAAGAATGGAGAACGCTAATACATTTCAAGCGCAAGGATGTGATGCAGATAGACGT
TGCACCACTCATTAGTGCGCTAGCAGGGCTTCCATATCCTCGAAACTCGGTAGGTGTTCTACCGTTTACGTACTTGACTAAGAACAAGTATCGTGTGAAT
GCCATGCGCGCCAATGCACAGCAGCTGTACCAGCATGCATTGCGCAAGGAAGAAGTGAAGCACGCTAACCGAGGGTTACTGTTCATTCCCTACGCACCAC
TTCACAGCCGTGTGCCAGATCTGATGGCCCATATTGACGAAGCCCTCAACAGCATTCCAGCAAGTGACGGTGAAAGCCATGCAATTCACAACGAGGCACA
CCATGTCATCGAAAAATTGATCCAGGAGATGATCGATATCTGCCGGAATGCGATCATATACTACCAGAGATATGACTGGTTGTTTTTGCTAGGATCAGTC
ATTCTAAGCTACGTCGGCTGGGCTCTAACCATGACTGTTGCCTATTTACAGCCCCAAAAATTCCGAGTGTCGTGGCTGTTGGTCCACATGATTGATGTAA
AGTTTGTTGCTGCTGTGGTAGTAGTGATGTGGTGGCGCTTTTTCGCCAACTCGCCATCGACATACTATCTGTATGGACTGTGTCCTCTTATCTTATGGAA
TTTCGTTTGGAACTATCGCGATAAACTCCAAGCTGCACTCCCTCTTGCTCAAGATTTTGGGTGGCAGCAGAGTGTTGAGATTGCAGCAATATTTTTGTGT
CTGGAGCAAGTTGTCCTTGGTTATCAACACCGAGCCATATTCAGCTTATTGTTCCTTCTGCTTGCGTTGAGGCCGAGAATTGCAGTTGGGCACGTTCGAG
AACCAACCCGTGGACTGTACCAAAGAGACGGTGGGAGAAAGTTGACGTCGCCAACTTTCTGGTGGTCTGCTAGTTGCCTGCTTATCGCTATATTCCCCTG
TTTGCCAAGTGACTACGATGAAAGCATCGTACTTGTACATATTGGAGCTTTGCTGACGTTGGTCTTCGCTTTCGTCGTACTCCGTGGCATTTCAACAAGA
CAGCACGTATCAAGGGATGTTCTTAAAATCGGGGTTCCACCGGTGCTAATGGCACAACTAACTCTGCAATGGACGACCAATATTCTCAGTAGTCAAGACA
CCCTGCCATTCTTCCTCGCCGCAGCAAATTGGGCGCTCGTGATGACACCTCCAATCTGCTTACTCGTTCAAACGAAATGGCTGAGCAACAAAATGCAGTT
ACCCTCGTTCAAGGCGGAAAAAGAGAGCAACGTGGAAAACCCGCAGCCTGGTGGAGATGTTATGCGCTCGATCACTGTTCGACTCGTAAAGGTGGTGCTA
GCATTTGAGCCAGCCTTTGTACTGCTCAGCACAGCGCACGAAGTCTTGTTCTACGCTGCGCTCTGCAGCGCGCTTGTAATTTGGCTTATGCTAGAAGGCA
AACGAAGTGATACTACAGGAGGTTCTGGTCGACGCGAGGTCCAACGAGCGTTGATGTTTTTGCTCCTTTCTCAAATCTCGTTTTTCGGGACAAGCAGCGT
GGCCAGTATGACACGTTTCCAGATCTCATCGACTCGCCGTTTCTTAACTGGTTCTACTTCTTCCACTGTACAGGCCCTGGTCGTGCTGAAGCTCCTCATT
CCGTTCGTGGTGGTTGCGTGCGCTTTCCGCCTTATTCTACTGTTACCAGCGGTATCAGCGTGGGGGAAGGAACAACAAGCAAAACCTGCTGGGGTGTCAC
GATATTTGCTCCTGGCAGTATCTATGGCGGACGTACTGGCGGTGCAATACCTCTTTCTCGTGAACAGCGAAGGAAGTTGGAAGCAGATGGGAAACTCCAT
CGCAGAATTTTGCATCGTGAACGCCCAGATAGTCCTTTTGCCAACACTCGTTATTATCGCCTGGTTGTTCGTGCACGACCTCGAATCTGTTGACAA