Description :
From Genome Similarity Track
Location :
Scaffold_82:62073- 64105
Transcript NameFunction/comments
Aphas_H257_15582phospholipid-transporting ATPase, putative

Sequence
2032 bases(100 bases per row)
AACGAAGACTTGGGGCAGATCGAGTACATTTTCAGCGACAAGACTGGCACATTGACGCAAAACATCATGGAGTTCCGCAAGTGCTCCATCGGCGGCGTCA
TCTATGGCTACGGGTCGACGGAAATCGCCAAAGCCGTGGCGAGTTTGGCCAAACAAAACCAACCGCCCACAGAATCGACCATAGCGTCGGCGGTGGAATA
CGGTCCTGGTCCAGCCGCCGACTTGAACGACGCGCAGATTTTCCTCGACAAAACCATTCACTTTGACGACCCCCGCCTCATCAGTGAGATTTCCACCGGC
GGGCCCAACGCCGCGCGCATCGACGAATTCCTGACGCTCTTGGCCGTGTGCCATACGGTGATCCCAGAGACCAACGGCACGACCGGCGTCACAACGTACA
GGGCGTCGTCGCCGGACGAAGAAGCCCTGGTGAAGGCGGCACGATGCCTCGGGTACACCCCCCACATATGAACACGTGGTTGTCGTTTTGGAACAACTGA
GATGTGACACTGTCAGGTACAAACTGGTGGCCCCCGCGCCGTTGGTGCAAGTGGAAGTATCGCTCAAGGCCAAGCCGTCCACGATGCAAACGTTTACGAT
CCTCAACGTGAACGAATTCAACTCGACGCGCAAACGCATGTCCACGGTGGTGCAATTCGCGGACGGCCGCATCGTCGTGTACTGCAAGGGCGCAGACAAT
GTCATCATACCACGGTGCAAACTCGACAGCTCGTCGGCGCAGCTGGACGAACACCTCAAAGCGTTCGCGTCCGAAGGACTGCGCACGCTTGTGCTGGCCA
AGCGGGAGCTCAGTGAAGCCGATTACGAAGCATGGAACAAAGTGTACCAGGCGGCGGCGACGTCGTTGACCGATCGGGACAACCTGTTGGACGCGGCCGC
GGAAGGGCTCGAAGTGAACATGGACATTGTCGGCGCCACGGCCATCGAAGACAAGTTGCAAGTGGGGGTGCCCAACACTATTCACAGCCTCGCGCAAGCA
GGGATCAAGATCTGGGTGCTCACTGGGGACAAGGAAGAGACCGCCGTGAACATTGGCCACGCGTGCCGCCTCTTAAACGACGGCATGCAGCTGCTGTTTA
TCAACCGCGAAAGCCTCGCGGAATTGACCGAGCAGGTTGTCTAGGTGCTTTTTGTCTTGGTCTCACAACTTGGGTAGCTCGAGTACTTGTACAACATGGA
CAGCATTCAATCGCATTACAAGGATAAGACCATTGCCGACAACATTGCCATCGTTTGCGATGGCAAAGCGTTGGTGCACTTTTTTCCGTCCAAAGCGTTG
ACCGTCGACGAAAAGGTCGTGGCGAAGGAACTTCGTCGGAAACTGCTCGTCGTCGCCAGCGTGTGCAAAGCGCTCATTGCCTGTCGCGTGTCCCCCGCCC
AAAAAGCAGATATTGTCAACATGGTAATTATAATCGCTATTGGACATGGATTCTGGGAAAAACAACTCATGCTGAATAGGTTCGATACCATTCCCACAAC
AAACCGATTACGTTGGCCATCGGCGACGGCGCGAACGACGTCAACATGATCCAGTCGGCACATGTGGGCATTGGCATTTGTGGCCAGGAAGGCGTGCAAG
CTGTGAACGCCAGCGACTACGCCATCGCTCAATTCCGGTACGAATACGCTTGATTCTTTGATTGATCATGATGAACGATGACGATGAGTTGACGATGGCG
GTAGGTTCCTTCAACGGCTGCTGTTGGTGCACGGCCGATCCAACTACAAACGCATTGCCAAAGTCATCTTGTATTCGTTCTACAAGAACATGTCGCTCGT
GATCGTGCTGTTCCTGTACAACTTTTACAACGGGCAGAGCGGCACGTCGCTGTTTGAGAGCTTTGTGATGGCGGGGTGGAACTTTTTCCTGGCGCTGCCG
ATCATTGCGATCGGCATCTTTGACGAAGACGTGAGCCCGGAGCAAGCGATGGCGTTCCCTCCGCTGTATTTGTCTGGTCAGCGCAACGAAGACTTGAACA
TCAAGTACTTTTCGTGGTGGATCTTCAACGCG