Description :
From Genome Similarity Track
Location :
Scaffold_854:6206- 8234
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_854-snap-gene-0.6Proly 4-hydroxylase

Sequence
2028 bases(100 bases per row)
ACAAATATGAGAGCGAGCTCGTGCATATCGACACGCAGAAACTGTTGACGCCGACACCCGATGCAAAGTGCCCCGAGTTTGCGGCACAGGGCGACTTGGC
GCATGTGGAGACGGTCATGGGCAATGCCGCAACATTGAAGCAGGAGCAACGTGTGTTCCTGATGCTCAACGGACAAAACGAAGGCATCTCCGTGAACTGG
AACTCTGACTCCAAGTGTTTGCATGAACTCGCGACGTTTGCGGCGCAGACGCTTGGCATGGATGTCGATATCCTTGCGAACGGCGTGAAGCTCATGAGCC
AGGACGGTCTTCCGATCGCAAGTGTGGAAGAACTCGACCAGCTGCGCATCGCGCACGTACTCTTTGACGGCCAGATCTGGGTGTGGCCGGGCATCAAGGT
CGGCCACAAATTTATGATCGAGAACTACAAGATCATGACTGCGTCGTTGCACCCCAAGGTGTTTACGGTCGAAGGATTCTTCACGCAGGAGGAAGCCGAT
TCGATTATGAAGCAGGGCATCGACCGCTTGTCGCGCTCGCCCGTCGACTCGCCTGACGCGGTGGATGGCTACCACTCGGATCGCACGAGCTACACGGCGT
TCTTGAACGACAACCAGTTCACGCGCGATTTCCGCGTGCGCACGGCGAAATTGACGCGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTCGCCGAGTT
TCGTTGAGCGCATGCAGTTGGTGCGCTACGAGACGGGTCAGTTTTTCCGCAAGCACGAAGACTACTTCGACTCGAAGCAGTTTATTCCAAAGAAAGAGCT
CGCGAGTCAAGAGTACGAAACGTGGACGAAATGGGCAAGTGCCAAGATCCAGGAGCTCAGTGCGACCCACGACATCCCGGAGCAATTCCGTGAAGGCGGT
GCGTTTTATCCGCGATTCGAAGACCAGATGACATTCCAGCACTCACTCCTGCAAGCGTTCATCGAAGACGTCGATCCGCTCGACTTCTTTGTGGAGCACG
CCGATGTCGAATGGGGCAAGTGGATCAAGGAAAACTTGGCGAACAAGGCGAACGATATCATCGGTCCATTGATGAAGGACAAAGGATACATGCTGCCGTA
CATGATCAAGGCGTGGGAAGCGCGCATTGGCCTCCCTGAGCTCCACTACAAGATCCCAAAGCGCCCATTGAGTGGTGTGACACACTACTTTCGATGGATC
CGCTGGGCCAAAGAGCGTACGCAGGATTTGCTCGACACAAATCCGAGCGCGATCTCTGCGGCCTTCCGTCCTGAAGGACCAGACTACCCAACGTACCACA
TTCGCTTCCAGAACCGTTTGGCCAAGTACATTCTAGAGGACAACACGCAGGAAGAACTCGCAGAGATCTTCACGCCTGAATGGGCTGAATGGCTGGTCAA
AAACCAGAACGCCAAGGATGTCCTCATTGAAGCACTTCGCGCAACGACCAAGGTCTTTGATCTGATTGTGAAGTCGTGGACCAAGCGCGCAGGAGAAGCC
TTTGCGTACAAGTAAGTTCTTGCATCGTTTGTTTTGTTGTTGTGGGGTATAGCTCACACGTGTGTCCATACTGTGTGCGATCTGTAGGATCCCAAAACAT
CTTCACCACTTCGAGCCAAACCGCTTCGTGACGGTGTTCTTGTACCTGAACGATTGCCCTGAAGGCGGCGAGACCGTGTTCCCGTACTCCAAAGAGCGTA
TGGTGACAGGCATCAAGCGTGAAGGAATGGATGAGTGCTCGGAGGGGTTGGCAGTGCCACCAACGAAGTTGTTTGCGTCGATGTTCTACTCACAGACCCC
AATGAACGACGTCGATCCTGCGAGTCTACACGGCGGCTGCCCTCCCCACCAAGGCGTGAAGTGTACGTACTTCACCCACATTATATCTTTTGTACAGAGC
CATGGCTCCTGACATCAATGATGTTTTTTTGTGGCGCATGTGATTGTGTAGATGGCGCAAACTCGTTCGCCTGGAATGCGGATGCTGACGAAGGCGCGAA
CGCCTGGGATCTCGGCTCGGACCTGAAA